Busch Lab

ZMP

cpo

Ensembl ID:
ENSDARG00000077688
ZFIN ID:
ZDB-GENE-070619-6
Description:
hypothetical protein LOC100005630 [Source:RefSeq peptide;Acc:NP_001139101]
Human Orthologue:
CPO
Human Description:
carboxypeptidase O [Source:HGNC Symbol;Acc:21011]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1190 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4827
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109756 Nonsense 61 363 3 9
Genomic Location (Zv9):
Chromosome 1 (position 4467466)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4880917
GRCz11 1 5578722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAATCAGATGCAAAGGGAAAACCCAGATGTYGTGTCCACCATGAYATA[T/A]GGACAAACATATGAGAAGAGGAACATTACATTACTAAAGGTATTTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1190
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109756 Essential Splice Site 247 363 7 9
Genomic Location (Zv9):
Chromosome 1 (position 4473349)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 4886800
GRCz11 1 5584605
KASP Assay ID:
554-1099.1 (used for ordering genotyping assays)
KASP Sequence:
CGTCCCCTACGGACACCCCAACATCTCTGCGCCCAATTACGACGAGCTGG[T/A]AAGCAGAAGAGAAAGCTTTTTTTGGAGGATATGTTAGCATCTCGGGAGCT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461