Busch Lab

ZMP

si:dkey-94e7.3

Ensembl ID:
ENSDARG00000077687
ZFIN ID:
ZDB-GENE-070912-612
Human Orthologue:
RP1
Human Description:
retinitis pigmentosa 1 (autosomal dominant) [Source:HGNC Symbol;Acc:10263]
Mouse Orthologue:
Rp1
Mouse Description:
retinitis pigmentosa 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1341105]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa17309 Nonsense Available for shipment Available now
sa8750 Nonsense Mutation detected in F1 DNA Not yet available
sa30596 Nonsense Mutation detected in F1 DNA Not yet available
sa19789 Nonsense Available for shipment Available now
sa11691 Nonsense Available for shipment Available now
sa10620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17309
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 105 2130 1 3
ENSDART00000133769 Nonsense 94 259 1 2
Genomic Location (Zv9):
Chromosome 2 (position 30448649)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30750284
GRCz11 2 30733817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAACACAYRCTGTCTGTTCCCTTGATGATGTGCAGGATGGGGGCTCTTA[T/A]CTGTGCTCGGATCAGAAGAAAGTCAAGCCTTTTAACTTGGACGAGGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8750
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 516 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30446843)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30748478
GRCz11 2 30732011
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGTACAGTKGGTGCGTACTCATACATGGAGCGGACTGCACAGGGAGAGT[T/A]GATGGAAGGCTACTGTGTGGTCAGTCGCAGCAGTAGCAGCAGCACAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30596
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 620 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30446532)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30748167
GRCz11 2 30731700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATACTGCACAAAAGCTTTGCCTCAAAGTAAGCCAGGCTCAACAGACTCA[G/T]GACCCTGTTCATCAAGTAACGATTGTGATGTTGATCTCACAAGGCAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 718 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30446238)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30747873
GRCz11 2 30731406
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAAAGCACTGCTGTTAATAAAAATAATTCACCAAAGTCCAAAAAATCA[A/T]AGCAAAGCACTTCTTCTGGATCATCTAGGCTTGGGAAAAACATAAAAGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25828
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 806 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30445974)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30747609
GRCz11 2 30731142
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACTTGAATCTTGATAATGGGAATCAAAGACCATCAGATAAAGATGTT[A/T]AGTTAAAAGATAAAACCATAAAAGACACTTCCCACAAGATAAACACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 854 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30445830)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30747465
GRCz11 2 30730998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATTGAATCACCAGCCCATCCAGCAAAACTAATAAAGAGGCTTCCGAAA[C/T]AAAGATCCATGAATGGTGTAAAACCAAAATCCTCTAAACCAAGACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10620
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 1187 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30444831)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30746466
GRCz11 2 30729999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTTTGCTCTAGAAGTGGACTTGGAAGGAGAAACGGATGATCAGGACAAA[C/T]AGCACAGTTTTAGTATTGCACAGTTACTGGATGAACTGAACATGCCTGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25827
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110515 Nonsense 1238 2130 3 3
ENSDART00000133769 None None 259 None 2
Genomic Location (Zv9):
Chromosome 2 (position 30444678)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 30746313
GRCz11 2 30729846
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGTCAGACTCAATCAAAGATGCTGAGAACATCAGTGACATTTTAGGT[A/T]AAAAGGAGGAAAACGATGATGGCTCCTTAGGTGGTAGTTTAGAGAAAGCT
Associated Phenotype:
Not determined