Busch Lab

ZMP

si:dkey-261l11.5

Ensembl ID:
ENSDARG00000077686
ZFIN ID:
ZDB-GENE-091118-25
Human Orthologue:
AAK1
Human Description:
AP2 associated kinase 1 [Source:HGNC Symbol;Acc:19679]
Mouse Orthologue:
Aak1
Mouse Description:
AP2 associated kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1098687]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27677 Nonsense Mutation detected in F1 DNA Not yet available
sa21810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27677
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058622 Nonsense 88 1055 2 22
ENSDART00000134851 Nonsense 88 219 2 5
Genomic Location (Zv9):
Chromosome 10 (position 42518225)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41221576
GRCz11 10 41143504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCCCTAAAGAGGATGTATGTCAACAACGAACATGACCTGCAGGTCTG[C/A]AAACGCGAGATCCAGATCATGGTGAGCATGATGAAATGTCTTCTGTGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27676
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058622 Nonsense 416 1055 11 22
ENSDART00000134851 None None 219 None 5
Genomic Location (Zv9):
Chromosome 10 (position 42490582)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41194121
GRCz11 10 41115361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATCTGCTAACTCCACACGATTGTTTCCTTACAGCTGTCAGTGTGAACT[T/A]GGCTCAGCCGGCGGCAGCTCTTCAGTCTCAGAAAGCCCAGGCGTCTCCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21810
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058622 Nonsense 701 1055 16 22
ENSDART00000134851 None None 219 None 5
Genomic Location (Zv9):
Chromosome 10 (position 42478839)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41182432
GRCz11 10 41103618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTACTGCTTTGTAATGTTGCTCTTCTCTGGATCTCATTTAGCTGAA[C/T]GACCTGCTGATATTCTTGGCTTGGAACCTGGAGCTGGTTTGCTAGCTGTG
Associated Phenotype:
Not determined