Busch Lab

ZMP

si:ch211-191a16.3

Ensembl ID:
ENSDARG00000077673
ZFIN ID:
ZDB-GENE-081028-40
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15562 Nonsense Available for shipment Available now
sa28530 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28529
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099821 None None 868 None 9
ENSDART00000146246 Essential Splice Site 140 487 5 6
Genomic Location (Zv9):
Chromosome 15 (position 40452452)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41969159
GRCz11 15 41926555
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCAGGATATTCTGACGGCTGACAGCCTTCCTGGAAGATTCATCCATCA[G/T]TATGTTAACAGACCAATGTGATTTATGTATTTGTGAATATTGACTGTTAT
Long Flanking Sequence:
CGGAGACTCACCTCGTAAATTTGAGTGAAAAAGGATGAGTGCAAATGATGAGATGTGAACTCTTATCAAATGCAGTTTCAGCAGTGGACAGCAGAGCATCCCTGACCCCCTACATTGACCAATGACAAGATGTCTTCTGCTGTTTGTTCATCTAAACTAATAATTTATGAAATCTGAGGGAAAAGAATAGACATAATAAATGACAGTGAAAGCTGCAAAGAAGTCCAAATCAATAGCACAGATTTACATTATGACTAGACAAAAAATTAATGCGGTTTTGGTGTAGCTAGTGTGCTGTGGGCTATTTTAGCAGGCTTAGGTTACTTTACCTGCTTGGTTGCAGAAAAGCAAAAGAATGAGTAAGACAAGATTATGTATGTAGAGTCACTGATGTTTTGATGCTGACTTCAAAATCTTATTTTGTCTGTAAGGTATTCACGAACAAAATATTATCAGGATATTCTGACGGCTGACAGCCTTCCTGGAAGATTCATCCATCA[G/T]TATGTTAACAGACCAATGTGATTTATGTATTTGTGAATATTGACTGTTATTGACGAATATATTTTCAACAGACAGGATTCCGAAACCCATAGACAAAAAATCCAAAGATTCAAATCAAACATAAAACAGAAACATCAGTACATTTTTGAAGGATTTGCAAAGCAGAGAAACCCAACACTCCTCAATGAGATTTACATAGATCTCTACATCACAGAGGGTGGGAATGGAGAGATCAGAAATGAACATGAATATAAAAGGATAGAAAAATCTCTGAAGACTGCAGCAACAGCAACAATACCTATAAAATGCAGAGACATCTTTACACCTTTACCTGGACAAGACAAAGCCATCAGAACTGTGCTGACGAAGGGAGTCGCTGGCATCGGAAAAACAGTCTCTGTGCAGAAGTTCATCCTGGACTGGGCTGAAGAGAAGGAGAATCAGGACGTCCAGCTCATCTTTCCACTTCCTTTCAGAGAGATCAATCTGATGAAGGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15562
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099821 Nonsense 2 868 1 9
ENSDART00000146246 Nonsense 152 487 6 6
Genomic Location (Zv9):
Chromosome 15 (position 40452558)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41969265
GRCz11 15 41926661
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATATATTTTCAACAGACAGGATTCCGAAACCCATAGACAAAAAATCCAA[A/T]GATTYAAATCAAACATAARAMAGAAACATCAGTACATTTTTGAAGGATTT
Long Flanking Sequence:
CCCCTACATTGACCAATGACAAGATGTCTTCTGCTGTTTGTTCATCTAAACTAATAATTTATGAAATCTGAGGGAAAAGAATAGACATAATAAATGACAGTGAAAGCTGCAAAGAAGTCCAAATCAATAGCACAGATTTACATTATGACTAGACAAAAAATTAATGCGGTTTTGGTGTAGCTAGTGTGCTGTGGGCTATTTTAGCAGGCTTAGGTTACTTTACCTGCTTGGTTGCAGAAAAGCAAAAGAATGAGTAAGACAAGATTATGTATGTAGAGTCACTGATGTTTTGATGCTGACTTCAAAATCTTATTTTGTCTGTAAGGTATTCACGAACAAAATATTATCAGGATATTCTGACGGCTGACAGCCTTCCTGGAAGATTCATCCATCAGTATGTTAACAGACCAATGTGATTTATGTATTTGTGAATATTGACTGTTATTGACGAATATATTTTCAACAGACAGGATTCCGAAACCCATAGACAAAAAATCCAA[A/T]GATTCAAATCAAACATAAAACAGAAACATCAGTACATTTTTGAAGGATTTGCAAAGCAGAGAAACCCAACACTCCTCAATGAGATTTACATAGATCTCTACATCACAGAGGGTGGGAATGGAGAGATCAGAAATGAACATGAATATAAAAGGATAGAAAAATCTCTGAAGACTGCAGCAACAGCAACAATACCTATAAAATGCAGAGACATCTTTACACCTTTACCTGGACAAGACAAAGCCATCAGAACTGTGCTGACGAAGGGAGTCGCTGGCATCGGAAAAACAGTCTCTGTGCAGAAGTTCATCCTGGACTGGGCTGAAGAGAAGGAGAATCAGGACGTCCAGCTCATCTTTCCACTTCCTTTCAGAGAGATCAATCTGATGAAGGACAAAACACTCAGTCTGTTAGATCTTCTTCAGCTCTTTTTCCCTCAAACTAAAGAAATGGAAATATCCAGTGACAAATATAGAGTGATGTTCATTCTTGATGGTTTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28530
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099821 Nonsense 180 868 1 9
ENSDART00000146246 Nonsense 330 487 6 6
Genomic Location (Zv9):
Chromosome 15 (position 40453092)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41969799
GRCz11 15 41927195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTGATGGTTTGGATGAATGTCGGCTTCCCTTAAATTTCAGAAGGAAC[G/T]AGACTCTGAGGGATGCAAACAAAGAGACATCAGTGGATGTGCTGCTGACG
Long Flanking Sequence:
ACATTTTTGAAGGATTTGCAAAGCAGAGAAACCCAACACTCCTCAATGAGATTTACATAGATCTCTACATCACAGAGGGTGGGAATGGAGAGATCAGAAATGAACATGAATATAAAAGGATAGAAAAATCTCTGAAGACTGCAGCAACAGCAACAATACCTATAAAATGCAGAGACATCTTTACACCTTTACCTGGACAAGACAAAGCCATCAGAACTGTGCTGACGAAGGGAGTCGCTGGCATCGGAAAAACAGTCTCTGTGCAGAAGTTCATCCTGGACTGGGCTGAAGAGAAGGAGAATCAGGACGTCCAGCTCATCTTTCCACTTCCTTTCAGAGAGATCAATCTGATGAAGGACAAAACACTCAGTCTGTTAGATCTTCTTCAGCTCTTTTTCCCTCAAACTAAAGAAATGGAAATATCCAGTGACAAATATAGAGTGATGTTCATTCTTGATGGTTTGGATGAATGTCGGCTTCCCTTAAATTTCAGAAGGAAC[G/T]AGACTCTGAGGGATGCAAACAAAGAGACATCAGTGGATGTGCTGCTGACGAACCTGATTGTGGGGAATCTGCTTCCCTCTGCCCTCATCTGGATCACCTCCAGACCAGCAGCAGCAGATCTCGTCCCCTCTGAGTGTGTCCATCGAGTGACAGAGGTACGAGGCTTCAATGACCCTCAGAAGGAGGAATACTTCAGCAAGAGAATCAGTGATCAGAGTCTGGCCAATACAATCATCTCACACCTGAAGTCCTCCAGGAGCCTCTACATCATGTGCCACATCCCAGTGTTCTGCTGGATCTCAGCCACTGTTCTGGAGAAGATGTTGAGTGAAGCAGAGACTGCAGAGATTCCCAAGACTCTCACTCAGATGTACACACACTTCCTGATGGCCCAGATCAACATTAAAGACATGAAGTATACTGAAAAAAAAGACAAAGACATTATCTTCAAGCTGGGGAAACTGGCGTATGAGCAACTGGAAAGAGGCAATATAATCTTC
Associated Phenotype:
Not determined