Busch Lab

ZMP

si:ch1073-210b3.2

Ensembl ID:
ENSDARG00000077661
ZFIN ID:
ZDB-GENE-081104-77
Description:
Novel protein similar to H.sapiens LRRC16A, leucine rich repeat containing 16A (LRRC16A) [Source:Uni
Human Orthologue:
LRRC16A
Human Description:
leucine rich repeat containing 16A [Source:HGNC Symbol;Acc:21581]
Mouse Orthologue:
Lrrc16a
Mouse Description:
leucine rich repeat containing 16A Gene [Source:MGI Symbol;Acc:MGI:1915982]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa36739 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36739
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111501 Essential Splice Site 12 61 2 3
ENSDART00000136542 None None 50 None 2
ENSDART00000141918 Essential Splice Site 57 106 3 4
Genomic Location (Zv9):
Chromosome 19 (position 139315)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 164472
GRCz11 19 164562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTATGTGTGTGTGTGTGTGTTTCACCGCTGTGTGTTTGTGTTTGAA[G/A]GACGTGGACACCATCTATCTGTCTCAGGACACCAAAGAGCTCTGCCTGCA
Associated Phenotype:
Not determined