Busch Lab

ZMP

si:ch211-102c2.5

Ensembl ID:
ENSDARG00000077653
ZFIN ID:
ZDB-GENE-081104-97
Human Orthologues:
AP005242.1, C9orf86
Human Description:
chromosome 9 open reading frame 86 [Source:HGNC Symbol;Acc:24703]
Mouse Orthologue:
B230208H17Rik
Mouse Description:
RIKEN cDNA B230208H17 gene Gene [Source:MGI Symbol;Acc:MGI:2442633]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa38472 Nonsense Mutation detected in F1 DNA Not yet available
sa40434 Nonsense Mutation detected in F1 DNA Not yet available
sa40435 Nonsense Mutation detected in F1 DNA Not yet available
sa726 Essential Splice Site Available for shipment Available now
sa38473 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38472
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111019 Nonsense 27 710 1 16
ENSDART00000142753 Nonsense 27 765 2 16
Genomic Location (Zv9):
Chromosome 5 (position 28451769)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26207067
GRCz11 5 26807220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCTGAGCCGGTTGGTCCTATAAAGGACAAGAACATCCCTGCTGGCCTA[C/T]AGTCTATGAACCAGAGTCTGCAGAGAAGATTCGCTAAAGGGGTTCAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111019 Nonsense 225 710 7 16
ENSDART00000142753 Nonsense 223 765 8 16
Genomic Location (Zv9):
Chromosome 5 (position 28459394)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26214692
GRCz11 5 26814845
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATCCATTATGCAGAATCTTCCATGAAGAACGGCTTTGGTTTGAAATA[T/G]TTGCACAGATTTTTCAACATTCCATTCTTGCAGCTTCAGGTAAGCAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40435
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111019 Nonsense 236 710 7 16
ENSDART00000142753 Nonsense 234 765 8 16
Genomic Location (Zv9):
Chromosome 5 (position 28459425)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26214723
GRCz11 5 26814876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGCTTTGGTTTGAAATATTTGCACAGATTTTTCAACATTCCATTCTTG[C/T]AGCTTCAGGTAAGCAGGTTGATGTTTTAGTATTTTGTCTGTTGTATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa726
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111019 Essential Splice Site 325 710 10 16
ENSDART00000142753 None 354 765 10 16
Genomic Location (Zv9):
Chromosome 5 (position 28461391)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26216689
GRCz11 5 26816842
KASP Assay ID:
554-0633.1 (used for ordering genotyping assays)
KASP Sequence:
CCTYCTCTCTCCACCAGCCAAGCTCCCRCGGYGTCTCCCTCCCCATCCCC[G/A]TCCCCTGCTCACCCCGGCCCAGCAGTCTCTGCTGCTCAGGCTCCTGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38473
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111019 Essential Splice Site 423 710 12 16
ENSDART00000142753 Essential Splice Site 453 765 12 16
Genomic Location (Zv9):
Chromosome 5 (position 28465381)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26220679
GRCz11 5 26820832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAATAAAACAAGTTCAATTTGCATCTATTCTTGTATCGTGTTTGTTTT[A/G]GTGAAGGGGAAGGAAGAGAAGGCAATCCCATGGTTGCTGGCTTCCAGGAT
Associated Phenotype:
Not determined