Busch Lab

ZMP

si:ch211-42i9.8

Ensembl ID:
ENSDARG00000077648
ZFIN ID:
ZDB-GENE-090312-31
Description:
folliculin interacting protein 2 [Source:RefSeq peptide;Acc:NP_001139090]
Human Orthologues:
FNIP1, FNIP2
Human Descriptions:
folliculin interacting protein 1 [Source:HGNC Symbol;Acc:29418]
folliculin interacting protein 2 [Source:HGNC Symbol;Acc:29280]
Mouse Orthologues:
Fnip1, Fnip2
Mouse Descriptions:
folliculin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2444668]
folliculin interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2683054]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa10994 Essential Splice Site Available for shipment Available now
sa15502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10994
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112490 Essential Splice Site 352 1083 13 30
ENSDART00000138276 Essential Splice Site 348 897 11 19
Genomic Location (Zv9):
Chromosome 1 (position 18530186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19095354
GRCz11 1 19788291
KASP Assay ID:
2259-0449.1 (used for ordering genotyping assays)
KASP Sequence:
TCCTCTTTTCGAGTCTCACATGAACAAACTCAAGACTGCCATCGAGAGGG[T/C]GAGTKTGAAAGCGCAGGACAGTGATTTATTATAGCAGCCTTTGTAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15502
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112490 Nonsense 609 1083 17 30
ENSDART00000138276 Nonsense 605 897 15 19
Genomic Location (Zv9):
Chromosome 1 (position 18538124)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19103292
GRCz11 1 19796229
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACCAATACACCYACYGGTCTAGAAGCGAGCAYGGTCAGGCCTGAATG[T/A]ACTGAAATGGGACCGGAATGTTTTGGAGAACACGTCGACTCTGTTGGAGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7902
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112490 Nonsense 752 1083 18 30
ENSDART00000138276 None None 897 None 19
Genomic Location (Zv9):
Chromosome 1 (position 18538577)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19103745
GRCz11 1 19796682
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGAAACATGGTTTCCACAAATATMTGTTGTCAAACAAACAAATGCATT[T/A]KAAACCTRACTGTKCACATCTACAGGACAGCGCTGCCTATTTGGTGTTCR
Associated Phenotype:
Not determined