Busch Lab

ZMP

si:ch211-66g24.1

Ensembl ID:
ENSDARG00000077633
ZFIN ID:
ZDB-GENE-081105-33
Description:
Novel protein similar to vertebrate membrane associated guanylate kinase, WW and PDZ domain containi
Human Orthologues:
MAGI2, MAGI3
Human Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
Mouse Orthologues:
Magi2, Magi3
Mouse Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI
membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34452 Nonsense Mutation detected in F1 DNA Not yet available
sa30903 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa772 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa34452
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Nonsense 26 993 2 16
ENSDART00000144255 Nonsense 138 1074 3 15
Genomic Location (Zv9):
Chromosome 8 (position 37823920)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36679335
GRCz11 8 36711769
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTTTTCCTGTCTTCCATGTCATGGCAGGTACAACTAGACAGCCA[C/T]GAGACGGTGAGATCTCTGGGGTCGACTATAACTTTGTGTCAGTCGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30903
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Splice Site, Nonsense 205 993 6 16
ENSDART00000144255 Splice Site, Nonsense 317 1074 7 15
Genomic Location (Zv9):
Chromosome 8 (position 37852209)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36707624
GRCz11 8 36740058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCATGCTGAACTCTGTCACCATCATCTTTCTGGTTTATTATTTGTAG[T/A]AGCAGAGTTTACGGACCAGCCGAGTGAACTGAGAGGTTTCTCCGTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa772
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Nonsense 285 993 7 16
ENSDART00000144255 Nonsense 397 1074 8 15
Genomic Location (Zv9):
Chromosome 8 (position 37855298)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36710713
GRCz11 8 36743147
KASP Assay ID:
554-0677.1 (used for ordering genotyping assays)
KASP Sequence:
ATGATACCTGTGTGCTCGGCTACTCTCACAAAGATGTAGTAGAAATGCTA[A/T]AAGCCATCCCTATTGGTCATACTGTGGACATCATGGTCCGAAGAGGTTAC
Associated Phenotype:
Not determined