Busch Lab

ZMP

elfn2

Ensembl ID:
ENSDARG00000077609
ZFIN ID:
ZDB-GENE-080327-26
Description:
Novel protein similar to H.sapiens ELFN2, extracellular leucine-rich repeat and fibronectin type III
Human Orthologue:
ELFN2
Human Description:
extracellular leucine-rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Elfn2
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 2 Gene [Source:MGI Symbol;Acc:MGI:360841

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15928 Nonsense Available for shipment Available now
sa10305 Nonsense Available for shipment Available now
sa14520 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15928
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 100 844 1 5
ENSDART00000139892 Nonsense 114 403 1 1
Genomic Location (Zv9):
Chromosome 22 (position 15154914)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14985462
GRCz11 22 15010037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCTCACCAAGAATGAAATCTCCTACATTGAGGACGGTGCCTTTGCAGGA[C/T]AGGCCAATCTACAGGTCTTGCAGCTGGGATATAACAAGCTTACCAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10305
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 193 844 1 5
ENSDART00000139892 Nonsense 207 403 1 1
Genomic Location (Zv9):
Chromosome 22 (position 15154633)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14985181
GRCz11 22 15009756
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAGTATGCGAACTAGCTGGAAATCCTTTCCACTGTGGCTGTGACTTGTA[C/A]ACCTTTCTTATTTGGCTAGAGGCATTTGACAATGTCACTCACACATACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 809 844 5 5
ENSDART00000139892 None None 403 None 1
Genomic Location (Zv9):
Chromosome 22 (position 15152560)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14983108
GRCz11 22 15007683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATMTGGGAGCGCTTCCGACCMTRCAAAAAAAGCCCCCGTGAGGAGGCATA[C/A]ATAGCCGCTGGTCATGCTCTTCGRAAGAAAGTGCAGTTTGCAAAGGATGA
Associated Phenotype:
Not determined