Busch Lab

ZMP

si:ch73-46g7.4

Ensembl ID:
ENSDARG00000077607
ZFIN ID:
ZDB-GENE-100922-233
Human Orthologue:
DUS2L
Human Description:
dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26014]
Mouse Orthologue:
Dus2l
Mouse Description:
dihydrouridine synthase 2-like (SMM1, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913619]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13440 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13440
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110221 Essential Splice Site 190 504 None 15
ENSDART00000135990 Essential Splice Site None 71 None 10
ENSDART00000139002 Essential Splice Site 190 504 None 16
ENSDART00000143046 None None 144 None 7

The following transcripts of ENSDARG00000077607 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37293104)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35706750
GRCz11 25 36256469
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTTCTTTAATGTCAGATTTGATCATGTTTGAKCATTGTCTTGTTGTC[A/C]GGATGAAAGACGAGCGACCGCGACACCCGGTGCACTGTGACTAYATCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30312
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110221 Essential Splice Site 275 504 10 15
ENSDART00000135990 Essential Splice Site None 71 9 10
ENSDART00000139002 Essential Splice Site 275 504 11 16
ENSDART00000143046 None None 144 None 7

The following transcripts of ENSDARG00000077607 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37292461)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35706107
GRCz11 25 36255826
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGGGGGCGCTGTCTGTGGACCAGGTCATGCAGGAGTACATCACATAC[G/A]TACGTTAGCACATGTTTACATCTACATAGACACATTGGCTTGAATTTACT
Associated Phenotype:
Not determined