Busch Lab

ZMP

si:ch211-284g18.3

Ensembl ID:
ENSDARG00000077581
ZFIN ID:
ZDB-GENE-030131-6450
Description:
ZZ-type zinc finger-containing protein 3 [Source:RefSeq peptide;Acc:NP_001093497]
Human Orthologue:
ZZZ3
Human Description:
zinc finger, ZZ-type containing 3 [Source:HGNC Symbol;Acc:24523]
Mouse Orthologue:
Zzz3
Mouse Description:
zinc finger, ZZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1920453]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11603 Splice Site, Nonsense Available for shipment Available now
sa39772 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5123
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114471 Nonsense 49 871 1 11
ENSDART00000134308 Nonsense 49 236 2 2
ENSDART00000137768 Nonsense 49 871 2 12

The following transcripts of ENSDARG00000077581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8590681)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9008335
GRCz11 2 8806340
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCGCCCAGCCGGAAGAGAGCTCTCCGCCTCCCGTGCCCAGAGCTCGCT[C/G]ACCCAAAAAGAAGCAGGACTGTCAGCAGCACCAGCAGACCGGAGCACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114471 Splice Site, Nonsense 629 871 5 11
ENSDART00000134308 None None 236 None 2
ENSDART00000137768 Splice Site, Nonsense 629 871 6 12

The following transcripts of ENSDARG00000077581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8608451)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9026105
GRCz11 2 8824110
KASP Assay ID:
2259-1597.1 (used for ordering genotyping assays)
KASP Sequence:
GCAACCAGAGCAAACCAGACACCTTCAACCAGCTGTGGACCATCGAGGAG[C/T]AGGTAGTACTAGTAGCTGTGAACTCTGAGACGTCTATAAACAAATTTAAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114471 Nonsense 701 871 8 11
ENSDART00000134308 None None 236 None 2
ENSDART00000137768 Nonsense 701 871 9 12

The following transcripts of ENSDARG00000077581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8613076)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9030730
GRCz11 2 8828735
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTATTGACTGAACGTCTTGTTTGTGACCGCAGGCCTCAAGTAAGCGA[C/T]AGCACCACCTCAACAAACACCTGTACAGGCCCTCAACGTTCCTCACCTCA
Associated Phenotype:
Not determined