Busch Lab

ZMP

si:ch211-193k19.2

Ensembl ID:
ENSDARG00000077572
ZFIN ID:
ZDB-GENE-060503-203
Description:
hypothetical protein LOC100034574 [Source:RefSeq peptide;Acc:NP_001076557]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10985 Nonsense Available for shipment Available now
sa32260 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10985
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122091 Nonsense 208 510 1 5
ENSDART00000144058 None None 114 None 2
Genomic Location (Zv9):
Chromosome 19 (position 44926825)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44061230
GRCz11 19 43656827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAWCAATGTGAAGAGGTAGCWGCAGCTCTGACAAGGGCACAWCCTTGTT[T/A]GGGTCAGCTAGGTTCTAAAACAGGATTTTGGGGTTGGAAACAGTCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122091 Essential Splice Site 408 510 4 5
ENSDART00000144058 None None 114 None 2
Genomic Location (Zv9):
Chromosome 19 (position 44927908)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44060147
GRCz11 19 43655744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCATTTACCTCAATGAAGATCCTGATTCATTCTTCAAGGCAAATTTGG[T/A]AAGTTTGATTGTTTCTTATGTAGTCTCTAACAGTGAAACTCTACAGTGTA
Associated Phenotype:
Not determined