Busch Lab

ZMP

CDH16

Ensembl ID:
ENSDARG00000077570
Description:
cadherin 16, KSP-cadherin [Source:HGNC Symbol;Acc:1755]
Human Orthologue:
CDH16
Human Description:
cadherin 16, KSP-cadherin [Source:HGNC Symbol;Acc:1755]
Mouse Orthologue:
Cdh16
Mouse Description:
cadherin 16 Gene [Source:MGI Symbol;Acc:MGI:106671]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa7280 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30891 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa34157 Essential Splice Site Available for shipment Available now
sa21051 Nonsense Available for shipment Available now
sa34156 Nonsense Mutation detected in F1 DNA Not yet available
sa21050 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7280
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 91 831 5 22
Genomic Location (Zv9):
Chromosome 7 (position 45940813)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44613641
GRCz11 7 44952866
KASP Assay ID:
554-4669.1 (used for ordering genotyping assays)
KASP Sequence:
AAATTGAGCAGAMGAATGTACATWTTCCCAGAGCTATTTGTCTTTATTTC[A/T]AGCTACNNNNNNNNNNNNNNNTGTCACATGKGTCCCTGACTCTCAGTTSA
Long Flanking Sequence:
CAGATCTCCCTCTGACCTATTCTGATCTGACTGTAAATGGTGATGATGAAGGGATTTTTGGTGTGGAGTCAGGTTTTCTGTATGCCCTTAAACCTCTGGACCGAGAAAAACAGCCATCTTACTCCTTACAGGTAAGAATCCTAAAGAGATGTCTGTCTGTCTGTCTGTCTATCTGTTCAAAATAAAACCAGCATCCACTTCAATTATTTTATTCAGTTACATTGCTGTTAACAGATGTGTTATGATGAAAATAGGAATTAGTTTTGCTTTTTAATATACTACTAATCTGTCTTCAAACTTTGAAATAAGAATATTGTAATTTAGGCCATTTATTTGCTGAAAGTGACAATAGGTCAACTTACATTTATCATTAGAATGTTTATATAGTGTTTTACAAAATTTTATATTTACATATTTATTTTTGTCGAGCTATTATTGATTTAGACAAATAAATTGAGCAGACGAATGTACATATTCCCAGAGCTATTTGTCTTTATTTC[A/T]AGCTACATTCAAAACACTGACTGTCACATGGGTCCCTGACTCTCAGTTGAAATAAAACCTACGTCATTGATTTGCTAGATTTTCAAAATGCAAAAAAAAAAAAACACATCCGGAGGTAGTCCAAAAATAACAAACGCTGACAGAAATTGCAGGCCAATGAAACGTGAACCCAAAAGGGTTTGAGCTCTAATAAGACATGCTGCTTGAGTGCTTTGACCTGAGTGCTTTTTTTCCAGGTGTCCTTCACAAAGTCCATGCACACTCAGAGCTTCACCGTAGAGGTGTGCGTCATCGATAAGAACGACAACGTACCGGTGTTCCTGGAAGAGAGCATGAGAGGCAGCGTGCAGCTGGGTCTTCTCAAAGGTGGGTGTGTGGAGCTCAGCGGGCTCTGACTGACAACTCTTTCTGCTGGATGACTTCTGCTTACACTAATTGCAACACTTGACTTTTTCTTATTTTTCAGCCATGACATGCCATGCTAAATGAGATGCTAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30891
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 109 831 7 22
Genomic Location (Zv9):
Chromosome 7 (position 45940535)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44613363
GRCz11 7 44952588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTCCAGGTGTCCTTCACAAAGTCCATGCACACTCAGAGCTTCACCGT[A/T]GAGGTGTGCGTCATCGATAAGAACGACAACGTACCGGTGTTCCTGGAAGA
Long Flanking Sequence:
CTACTAATCTGTCTTCAAACTTTGAAATAAGAATATTGTAATTTAGGCCATTTATTTGCTGAAAGTGACAATAGGTCAACTTACATTTATCATTAGAATGTTTATATAGTGTTTTACAAAATTTTATATTTACATATTTATTTTTGTCGAGCTATTATTGATTTAGACAAATAAATTGAGCAGACGAATGTACATATTCCCAGAGCTATTTGTCTTTATTTCAAGCTACATTCAAAACACTGACTGTCACATGGGTCCCTGACTCTCAGTTGAAATAAAACCTACGTCATTGATTTGCTAGATTTTCAAAATGCAAAAAAAAAAAAACACATCCGGAGGTAGTCCAAAAATAACAAACGCTGACAGAAATTGCAGGCCAATGAAACGTGAACCCAAAAGGGTTTGAGCTCTAATAAGACATGCTGCTTGAGTGCTTTGACCTGAGTGCTTTTTTTCCAGGTGTCCTTCACAAAGTCCATGCACACTCAGAGCTTCACCGT[A/T]GAGGTGTGCGTCATCGATAAGAACGACAACGTACCGGTGTTCCTGGAAGAGAGCATGAGAGGCAGCGTGCAGCTGGGTCTTCTCAAAGGTGGGTGTGTGGAGCTCAGCGGGCTCTGACTGACAACTCTTTCTGCTGGATGACTTCTGCTTACACTAATTGCAACACTTGACTTTTTCTTATTTTTCAGCCATGACATGCCATGCTAAATGAGATGCTAATTTGTTAGTCTGAATGTCAAACATTTTCCACACTATACCATGAATTGGAGTAGCGTAATAGCACACAGTAGTTGTAACTGAGTGCTGTATATATTTATCTATAAATGAGCAATATCACACGAGCAGCAGTGTGATATGGCTGTATAACAGCACTGGTGGGATGCGTGTGTTGGTGCGAGGCCGCAGGCTGAGTGCCTTAGTGTCCCACCAGTGATGATATACAGCCATATCACACTTCTCTGAGTGAAGTATTGTGTTTATAAAATAGTTTGACAACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34157
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 191 831 8 22
Genomic Location (Zv9):
Chromosome 7 (position 45934874)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44607702
GRCz11 7 44946927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTCTCAATCGACTCCATCACTGGAGAAGTGTCCCTCACAGAAGATGG[T/C]AATACTTGTCTCTGACTAACATGATGATTAATGAATAGTCTGACTCATAT
Long Flanking Sequence:
CACAGTAAATAGAAGATGACATTTCTCTGTTTCATTTTTTTATTTATTTATTTACTTTCAAACATTTGAATTGTAAGTGGTATTTGCTTTTAAATGTTGCTTTGTGACCAATTCTGTTTGCTTCCTGTTTCCTTTCACACTGTCTGTATTAATAAAATGCACAGAATTATATTTCTTAGAAAGAGCTATTTCTGAAATTCAGTTGTGTTAATATGCAAATAAACACCATTTGCTCATCAGTCTAAATGTGTCAATCCAGTCTCTTCATATAGATTGTAATAAAAAAATAAATAAAAATAAAAATCTGCTGTCTGTCTGTGTGTTTGTGTCATTTTCACAGGTATCCCGTTCATGCAGGTGGAAGCGCTGGACCGAGACGACCGAAACACTGCCCACGCAGACCTGCGCTTTAGTCTTCTGGACCAGATACCGCGCATCCCTGCCAGCCACATGTTCTCAATCGACTCCATCACTGGAGAAGTGTCCCTCACAGAAGATGG[T/C]AATACTTGTCTCTGACTAACATGATGATTAATGAATAGTCTGACTCATATATTCGGTAAAGAAGAATTAATAATGTATTAGATCAGTTAGTGCCTCCATGTCATTGCGTTGACTAATCAGACCTTGAAAATATGGAATACTTAATCTGTTATGTGAGTATTGGGTTACATTTTAATTTGGGCACCAATCAACAGTATTAGAAAAATGTTATGAAAAAGGAGAGTTCCAGTCCTTGATTCTGATTGGCTGAGCCAAATGGGATGCTGTTGTTAAGTACTCTACAAGCATATGCCTTTGACTGTTGCATGGCAACCATTCCACTATTGAAAAAATGCACAAAAGCATGCACATAACTTTAAATGACTGCTCAGCCAAACAGCAAAAATTGCAAAATCATATATTCAAAAAGGCAGCAATACCAAAGCTCCAAAAATAGCAATTTATTGAATTAAAAAATTAATTTGTATTTGAAATATGACATGCCTTCTAACAATTCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21051
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Nonsense 234 831 9 22
Genomic Location (Zv9):
Chromosome 7 (position 45929626)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44602454
GRCz11 7 44941679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCTTCTCCACTGGAACTGTGCTGGTGGAAGTGACTGGGAATGCAT[G/A]GGCCTCTCCAGACCCTGTGAGGCTGCAGGAGAATCTGCCTGGACCATATC
Long Flanking Sequence:
ATTTTTTCTCTGAAAGCATTTTAAAGTTTCCTTGGCTGTGTTTTGGATCATTGTCTTGCTGTCTTGTCTCACCCTGGTTTCATCTTCATCATAATGTAGGCTGCTGAAAAACTACTGAGAGATTTCAGCTGCTGTCGGGCTTTCATTACCTTTTTACACCTCCCTTTCTTTGTGTTTTCAATACTTTTTCTCTGCATCATTTCATTTCATTACACATAACTTATTTCTTTGATTGTTACTAACATCTGGTGAAAATTTCAAGTCAACGACACCTTTAGGAATGTGTGTTCAAAGAAAAAAGGTGGCTTGTTCAATACATATTTTCCCCGCTGTAAGCATAGATACCTTTGTAAACGTATCCATCTGTGCAGGTGCTTCAACATTGGATCCAGAGATGTGTGGCCGCTACAAGCTCTCTGTAATGGTGCAGGACATGGCAGGCAAGGCCAATGCTTTCTTCTCCACTGGAACTGTGCTGGTGGAAGTGACTGGGAATGCAT[G/A]GGCCTCTCCAGACCCTGTGAGGCTGCAGGAGAATCTGCCTGGACCATATCCCATCCCAATCTCACAGGTATGATGAAAAGAGCACTGGCGGCATGACACAGATGGGCATAGGTGAGTATGTTTCATATTGCGTGCATCCTCTTCAAAGGCGAGTGTGGCAACATCCCATAATTGCACAAGGCTTTCATCATCACATGACCTCTTGTTAGATGTTCAGATTTTGTGATATTATTCATGACTCACTGCCATCTTAGCAAAAATTCCCATATTTGAAACACCTAATATTGTGATGGTAAATATGCTATATATCATACTGCATAATATATTTATAAGAATATGTACGGTTTATATTAGGACTACCGAATGCTAAGGAACATTCTGTTGTTCTCAGTTATCTTCAGTGAAACTCATAGCTATAGTATTTCCATTAGCTGACCATTTTTGTTGTTTAGTGAAATGCCCTGTCAATCATCTTCTCACGTCCTCCACATGTATATAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27025
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Nonsense 293 831 10 22
Genomic Location (Zv9):
Chromosome 7 (position 45899418)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44572246
GRCz11 7 44911471
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTCACTATCAACAGAGAAGGGATCATTTACCTGAATGCTCCTCTGGAC[A/T]GAGAAACACAAGACCAGGTGAAGAAAAAGCAAACTTCAGTCACACTCGTG
Long Flanking Sequence:
ACAGCTGGAGGGTGAGGTATTGAGGAGATACATATGTCCCCCTCGCTCGCCTTCTAACGGGCTCCACTCCTTCTTCGGTGCGTTTCCACACCCCTTCCAGAACCGTTTGCATCATTTGTGGCAGCACAGTGGAAAATCCCTCCATGGCGAGGGCAGCTGGTTTGTTTTGGCAGATGCAGGCCTCACCGCACTTATCAGCAGTGCCTAAACATGCAGGGTTTTCCTCAAACACTGTATCTCATCGCTGTATAAATCTGACGTCTAAGCCATTTAGATTGTGCTCTCATTTTTGCCTTGTGAATATTGTATAATGAAATGGTTTAATATATGATGTAATGGTTTGCTCTGTCATTCAAACATGTTTTGGTTGTTTTGTTTATGTGTGTTCCCAGGTGAAGTGGAGCGGGAGTCCGGTTGAGTATAGTCTTGAGGGAGAGTTTCCAGAAATGCTCTTCACTATCAACAGAGAAGGGATCATTTACCTGAATGCTCCTCTGGAC[A/T]GAGAAACACAAGACCAGGTGAAGAAAAAGCAAACTTCAGTCACACTCGTGTAGATTTACATACAGTACTAAAACTTGATTTCACAGTAAAGACTAGATTTAAGTGAAGTATGGGACATTTAAGTCATTTATTTGAATGTGTCTTAGAATAAAAAGCATTATGGGTGTTCATCTTGAGAAAAAAAAGGCACTGAATTGTTTTACGAATAACCAGCACAAGCTAGTTTACATTTAAACAACTCTGAATTTGTATTGTTAGATTTTCTTAACAAATAAATCTAATGTACAAATATATGGATATCTGTTATTTCCTTAAATAATAGCAAAATAGCAATGCTTTTACATTTTATAATACTATTGTATTATTTTAATAAGGTGTACATTATCAAATCTCTTAGTAAAAACTTTAAACTGATCACACTTGTAGTGCCAGTTGTTCTTTCAAAACCTGACATCATGCTTTCATTGTAGTTACACATGCTTTCATTTCAGCTAATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34156
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Nonsense 669 831 17 22
Genomic Location (Zv9):
Chromosome 7 (position 45858321)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44531149
GRCz11 7 44870374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACACATTCTGGATGTGAATGACAACAGCCCGGTTCTGGTGGGCGATTA[T/A]TCCTGGAAGTACCTGTGCACACCTCGCTGGGAGGATCAGGCTCTGGTTCT
Long Flanking Sequence:
TGTGATAATGAATGGATTATCATGCACCCACAGTTAAAGTTAGGCCTATAATCTGTTCAAAGAATGGTTAAAGCAAAAGCGGGAACTACTGCTGCTTATAAAAAGACATTTTTAGTTACATGCCTAATGTTTCAGGTTTTTTTATATAAAACTATGTAGCAAAATAAAAGAACAATAGAAGGCAAAATAAATGTTTTGCTAATAAATACAGCTTTAAAATAAGCATTTTCTCTAGACAACCAGTTTGGGCCTTTAAAAAAATATTCTGAGAAAAAGGTGGGCCTTGAAGTGAAAAAGGTTGAGAACCCCTGCCATAGTGGACCACAAGTAAATTCATGGAACAAGTGTTGCATGGACACCTTAAGATAGTCTCACCACAAATGATTGATATTTCTTCATCTACTGTCTCCTCTAGGTAACTCCTCTCTGTCCGCCTCCACACTGGTGACTGTACACATTCTGGATGTGAATGACAACAGCCCGGTTCTGGTGGGCGATTA[T/A]TCCTGGAAGTACCTGTGCACACCTCGCTGGGAGGATCAGGCTCTGGTTCTGGCCTCTCGGGACAGTGATGGCCCTCAGCATGGAGGAAGGCTCAACTTCTCCCTCCGCAGTGATGCCACTGTCCGCCGCACCTGGAAACTCACCCCCATCAATGGTTCGTGTATCCTACTCTTCCACCTGTTGAGCAATAGCTGTGTTGAGTAAGAAGGGACAAACTCACCAAGAACTACATGACCCATCTTTTAAAAACCTAGTCTGTCAGTCATTTTAAAAAGCACACGCTTCTCCAGTGTATAATTCCTGTAATGTTCCCAAACCTTCAATAATCACAATAGCGCTGACACCAGTTGTGCTGACCTCCGCTAGCAATGACGTCAATGTGGATAAAATTAGAGATCTGAAAACAGAAAAAAGTGCTGTTCGGTAGATGTAGCGTCCAGGCAGTCAAACTGAAACGTCATCTGAATTGGGTGTAATGCTTACAACCCGCTGAATCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21050
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 720 831 17 22
Genomic Location (Zv9):
Chromosome 7 (position 45858166)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 44530994
GRCz11 7 44870219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCAGTGATGCCACTGTCCGCCGCACCTGGAAACTCACCCCCATCAATG[G/T]TTCGTGTATCCTACTCTTCCACCTGTTGAGCAATAGCTGTGTTGAGTAAG
Long Flanking Sequence:
GTAGCAAAATAAAAGAACAATAGAAGGCAAAATAAATGTTTTGCTAATAAATACAGCTTTAAAATAAGCATTTTCTCTAGACAACCAGTTTGGGCCTTTAAAAAAATATTCTGAGAAAAAGGTGGGCCTTGAAGTGAAAAAGGTTGAGAACCCCTGCCATAGTGGACCACAAGTAAATTCATGGAACAAGTGTTGCATGGACACCTTAAGATAGTCTCACCACAAATGATTGATATTTCTTCATCTACTGTCTCCTCTAGGTAACTCCTCTCTGTCCGCCTCCACACTGGTGACTGTACACATTCTGGATGTGAATGACAACAGCCCGGTTCTGGTGGGCGATTATTCCTGGAAGTACCTGTGCACACCTCGCTGGGAGGATCAGGCTCTGGTTCTGGCCTCTCGGGACAGTGATGGCCCTCAGCATGGAGGAAGGCTCAACTTCTCCCTCCGCAGTGATGCCACTGTCCGCCGCACCTGGAAACTCACCCCCATCAATG[G/T]TTCGTGTATCCTACTCTTCCACCTGTTGAGCAATAGCTGTGTTGAGTAAGAAGGGACAAACTCACCAAGAACTACATGACCCATCTTTTAAAAACCTAGTCTGTCAGTCATTTTAAAAAGCACACGCTTCTCCAGTGTATAATTCCTGTAATGTTCCCAAACCTTCAATAATCACAATAGCGCTGACACCAGTTGTGCTGACCTCCGCTAGCAATGACGTCAATGTGGATAAAATTAGAGATCTGAAAACAGAAAAAAGTGCTGTTCGGTAGATGTAGCGTCCAGGCAGTCAAACTGAAACGTCATCTGAATTGGGTGTAATGCTTACAACCCGCTGAATCACACACACACACGGCGCAGAGTGTACTGACAAAGAAGGAAATTGCCCTCCATGTCTAGTGTCTTCAGATGAATCTGTCTTGGACGTAATAAGCGTAATGGCTCTCGTCCTGATAGCTTTAGGCATCATTAATGTGCCAAGCTGATGCCGGTGAGCAGGT
Associated Phenotype:
Not determined