Busch Lab

ZMP

si:ch211-251j10.5

Ensembl ID:
ENSDARG00000077536
ZFIN IDs:
ZDB-GENE-030131-1217, ZDB-GENE-081105-64
Description:
U5 small nuclear ribonucleoprotein 200 kDa helicase [Source:RefSeq peptide;Acc:NP_001116729]
Human Orthologues:
HELQ, POLQ, SNRNP200
Human Descriptions:
helicase, POLQ-like [Source:HGNC Symbol;Acc:18536]
polymerase (DNA directed), theta [Source:HGNC Symbol;Acc:9186]
small nuclear ribonucleoprotein 200kDa (U5) [Source:HGNC Symbol;Acc:30859]
Mouse Orthologues:
Helq, Polq, Snrnp200
Mouse Descriptions:
helicase, POLQ-like Gene [Source:MGI Symbol;Acc:MGI:2176740]
polymerase (DNA directed), theta Gene [Source:MGI Symbol;Acc:MGI:2155399]
small nuclear ribonucleoprotein 200 (U5) Gene [Source:MGI Symbol;Acc:MGI:2444401]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa21333 Nonsense Available for shipment Available now
sa17773 Nonsense Available for shipment Available now
sa25398 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21333
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 270 2134 7 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31897303)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31040029
GRCz11 8 31049261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGGATCTTCACCCTCGAGACATCGATGCCTTCTGGCTTCAGCGA[C/T]AGCTCAGCCGCTTCTACAACGATGCCATCGTGTCCCAGAAAAAAGCAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2464
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 435 2134 11 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31896366)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31039092
GRCz11 8 31048324
KASP Assay ID:
554-3445.1 (used for ordering genotyping assays)
KASP Sequence:
ACTTCATGGCCAACAAGCGCTGCCAGCTGCCTGACGGCTCCTTCCGCAAA[C/T]AGAGAAAGGGCTATGAGGAGGTTCATGTGCCTGCACTCAAACCCAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17773
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 1016 2134 22 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31890504)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31033230
GRCz11 8 31042462
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGCTGCTAAAGCCCACACTGAGTGAGATCGAGCTCTTCAGGGTGTTCT[C/A]GCTTTCATCKGAGTTTAGGAAMATTACTGTCAGAGAGGTACGTGCCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25398
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 1074 2134 24 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31890148)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31032874
GRCz11 8 31042106
KASP Assay ID:
554-7358.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGCTGCAGGCATATATCTCTCAGCTCAAACTGGAGGGCTTTGCTT[T/A]AATGGCTGACATGGTCTATGTGACGCAGGCGAGTGTAGAATAAAATCTTG
Associated Phenotype:
Not determined