Busch Lab

ZMP

zgc:172324

Ensembl ID:
ENSDARG00000077532
ZFIN ID:
ZDB-GENE-080204-114
Description:
GPI ethanolamine phosphate transferase 1 [Source:RefSeq peptide;Acc:NP_001121709]
Human Orthologue:
PIGN
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class N [Source:HGNC Symbol;Acc:8967]
Mouse Orthologue:
Pign
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class N Gene [Source:MGI Symbol;Acc:MGI:1351629]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12721 Nonsense Available for shipment Available now
sa45830 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12721
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Nonsense 257 681 7 28
ENSDART00000084954 Nonsense 259 932 7 29
ENSDART00000129028 Nonsense 259 932 6 28
Genomic Location (Zv9):
Chromosome 24 (position 24317437)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23564315
GRCz11 24 23709489
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTCACTGTGATGGATGACTTTTATGGCCATGATGGAAAAACGGCTTA[T/A]GTTTTTACTTCYGACCATGGCATGACAAATTGGGGTAAAACATCTCTCTG
Long Flanking Sequence:
ATTCTTCAGTGTATCTTCATTCGTGTTCTGCAGAAGGAAAAAAAGGATGAGTAAATGAAGACAGAATTCCATTTTTTTTTTTACAAATAGTCCATTTCAATGTGGTAATGTCATAGGCCCTTGAACATTTCCTGCTTGTTATCATAATTTAACTGTAACAAGAGGCAATTCAATCATAACTTCATGTTAAAACTGCTATCATAGCATTATTTGTCAATATGTGGACCTCTTTGGATTCTTGAAATCTATGGAAATAAAAAATGTAAAATAGGAAAATGCATTAGGACCATTGTTATTGTTTAAGTCCCTCGAAATGGTCAATAAAATCCACAAGGACCAAATATACCACTAGATGGTGCTACAGTAGCTGTCAAAGCCTTGCATTTAATATTTTCTGCTTCCAGGGAATGTCTAGAGAACATTGGTCTGGTTGATGCTGGTGTCGCTGACATTGTCACTGTGATGGATGACTTTTATGGCCATGATGGAAAAACGGCTTA[T/A]GTTTTTACTTCTGACCATGGCATGACAAATTGGGGTAAAACATCTCTCTGACCTAGTCTTTAGAAGTCTAAGATAGGATGTTTTGTTAACATAATTTTATCCGTCTAAATTAAGTCCAAAGTTTATAAATCAAATAGCATTCTTTTGATTTATATCACTGTTCAAGTTCAAATCAGCAGAACTTATCCACCTTTTGCCTCCCTTGACTATTGCATTTCAAATGATTGGTTGCACTAAAAGAACTGAAACAAAACTAATTTAGATAATAAGGTGGCTTAAGATATACGTATATAGTGTACATATAATGAAGACTGATATTACGAAAACTGCTTGGTACTGAGATTAGTATAAAAGTGTATTTATTTAGAGGTTTCTTTAACGATTTTGCGGTCTGCTGAAAATAATTTACTGTGAGAAGAATTATGTACACAATGATTTAAGAAATGCTTCATCAATTGTTAACAGTTTATTGTAAGTTACTCCTATAATTCACTCAAAGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4296
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Nonsense 338 681 10 28
ENSDART00000084954 Nonsense 340 932 10 29
ENSDART00000129028 Nonsense 340 932 9 28
Genomic Location (Zv9):
Chromosome 24 (position 24315549)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23562427
GRCz11 24 23707601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCTGATATTGCCCCACTAATGTCATCTCTTATAGGCATTCCCTTTCCTT[T/A]GAACTCTGTGGTGAGCTTAATTTTAGAGATTTGAGATCTGCAATTCATTT
Long Flanking Sequence:
TAGATGCGTATGTATTTATTTATTGGGTGCTAGTATTTAAGAAATAATTACTAGTAGGAAGGTAAGTTTGACCTGTGGTTTGACCTATATTCAGAATTTGTTCTCTGCATTTACCATATCTTAAGTACACACACCTGCACAAATGTAAACATACAGTCTTAGCAGAGGGTAGCCACTCTATCTAAAATATGTACTTCTAAATATGTATAGTTTTTAGAATAAATGTGAAATCTTTTGTTTTACTAATACCCCCCCATCTCTATTAACAGACATTAAATCACCATAAACCAACAAAATAGATTGTCTTTTAACATTCTTTGCCTTTCAGAATGGGGGTTAGAGAGCTACAGGAGAGTGGACGTCAATCAGGTGAGATTTTCTTTCTGATTTACATATGAAATGTCTATAAAGGATGAAATATTGCTGATCTGATCTTTTCATGCTGTTGCAGGCTGATATTGCCCCACTAATGTCATCTCTTATAGGCATTCCCTTTCCTT[T/A]GAACTCTGTGGTGAGCTTAATTTTAGAGATTTGAGATCTGCAATTCATTTTGTGAACTTGCACACATTGCTTATATAATCTTCTGAAGTATTTTTGTTGCTTTACAGGGGGTTTTACCGCTGAGTTACCTGAATAACAGCCAGCACTTTAAGGCTGAGAGCATGTATGCAAATGCTATTCAGATCTTGGAGCAGTTCAGGGTAAAGTATAGTACATTTCAGTTCATTCTGGTTGGTTTATTTAAATTAGTTAGCTATTTTTTTTTTTTTTTAATCCACAGGTAAAATTGGCACAGAAGAAAGAAACAACGATATCGTTTTTGTTCACACCATACCAGTGAGTATAAGTCAGTGCTAAGGGAGAGTTTAACAAACAGACATTTCTTGAATTCTTAGGTATATATTTGGGTATATTTAATTTATAATTTATTTTATAAAGGTCTGTTAACCTTTCCTAAAACTTCAAATAAAAGTATAGATTAAAATAAACAATAGCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Essential Splice Site 372 681 11 28
ENSDART00000084954 Essential Splice Site 374 932 11 29
ENSDART00000129028 Essential Splice Site 374 932 10 28
Genomic Location (Zv9):
Chromosome 24 (position 24315348)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23562226
GRCz11 24 23707400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCTGAGAGCATGTATGCAAATGCTATTCAGATCTTGGAGCAGTTCAGG[G/A]TAAAGTATAGTACATTTCAGTTCATTCTGGTTGGTTTATTTAAATTAGTT
Long Flanking Sequence:
TATGTATAGTTTTTAGAATAAATGTGAAATCTTTTGTTTTACTAATACCCCCCCATCTCTATTAACAGACATTAAATCACCATAAACCAACAAAATAGATTGTCTTTTAACATTCTTTGCCTTTCAGAATGGGGGTTAGAGAGCTACAGGAGAGTGGACGTCAATCAGGTGAGATTTTCTTTCTGATTTACATATGAAATGTCTATAAAGGATGAAATATTGCTGATCTGATCTTTTCATGCTGTTGCAGGCTGATATTGCCCCACTAATGTCATCTCTTATAGGCATTCCCTTTCCTTTGAACTCTGTGGTGAGCTTAATTTTAGAGATTTGAGATCTGCAATTCATTTTGTGAACTTGCACACATTGCTTATATAATCTTCTGAAGTATTTTTGTTGCTTTACAGGGGGTTTTACCGCTGAGTTACCTGAATAACAGCCAGCACTTTAAGGCTGAGAGCATGTATGCAAATGCTATTCAGATCTTGGAGCAGTTCAGG[G/A]TAAAGTATAGTACATTTCAGTTCATTCTGGTTGGTTTATTTAAATTAGTTAGCTATTTTTTTTTTTTTTTAATCCACAGGTAAAATTGGCACAGAAGAAAGAAACAACGATATCGTTTTTGTTCACACCATACCAGTGAGTATAAGTCAGTGCTAAGGGAGAGTTTAACAAACAGACATTTCTTGAATTCTTAGGTATATATTTGGGTATATTTAATTTATAATTTATTTTATAAAGGTCTGTTAACCTTTCCTAAAACTTCAAATAAAAGTATAGATTAAAATAAACAATAGCTTAAATTATATATATAAAATATAATAATATTGTACAAAAATAACAGTAGAACTAGAGATACTCAAACTAGGGTCCGACAGGATCAACAGGCTGGCGCAGAAACTCCATTGAATATACTGGGGTAAAATAAATGTTAATAATTTAAAGACATGATGCAGAACAATGTAATATAATGCAGTGCTTCTTGTACATTCTGAGACCAACTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4290
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Essential Splice Site 391 681 12 28
ENSDART00000084954 Essential Splice Site 393 932 12 29
ENSDART00000129028 Essential Splice Site 393 932 11 28
Genomic Location (Zv9):
Chromosome 24 (position 24315211)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23562089
GRCz11 24 23707263
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGCACAGAAGAAAGAAACAACGATATCGTTTTTGTTCACACCATACCAG[T/C]GAGTATAAGTCAGTGCTAAGGGAGAGTTTAACAAACAGACATTTCTTGAA
Long Flanking Sequence:
AGAGAGCTACAGGAGAGTGGACGTCAATCAGGTGAGATTTTCTTTCTGATTTACATATGAAATGTCTATAAAGGATGAAATATTGCTGATCTGATCTTTTCATGCTGTTGCAGGCTGATATTGCCCCACTAATGTCATCTCTTATAGGCATTCCCTTTCCTTTGAACTCTGTGGTGAGCTTAATTTTAGAGATTTGAGATCTGCAATTCATTTTGTGAACTTGCACACATTGCTTATATAATCTTCTGAAGTATTTTTGTTGCTTTACAGGGGGTTTTACCGCTGAGTTACCTGAATAACAGCCAGCACTTTAAGGCTGAGAGCATGTATGCAAATGCTATTCAGATCTTGGAGCAGTTCAGGGTAAAGTATAGTACATTTCAGTTCATTCTGGTTGGTTTATTTAAATTAGTTAGCTATTTTTTTTTTTTTTTAATCCACAGGTAAAATTGGCACAGAAGAAAGAAACAACGATATCGTTTTTGTTCACACCATACCAG[T/C]GAGTATAAGTCAGTGCTAAGGGAGAGTTTAACAAACAGACATTTCTTGAATTCTTAGGTATATATTTGGGTATATTTAATTTATAATTTATTTTATAAAGGTCTGTTAACCTTTCCTAAAACTTCAAATAAAAGTATAGATTAAAATAAACAATAGCTTAAATTATATATATAAAATATAATAATATTGTACAAAAATAACAGTAGAACTAGAGATACTCAAACTAGGGTCCGACAGGATCAACAGGCTGGCGCAGAAACTCCATTGAATATACTGGGGTAAAATAAATGTTAATAATTTAAAGACATGATGCAGAACAATGTAATATAATGCAGTGCTTCTTGTACATTCTGAGACCAACTTTATATTGTATATCAATCAGGCAGAGGACATTGTTGATTTTTAAAGAAAACAGACCTTAAACGCTCCGATTTTGTAACGGCATAAAGTTCACTGAAATAATCTGGGTCAACTCTTAATAGTCCTTCCGCATACTTCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19341
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 Essential Splice Site None 681 None 28
ENSDART00000084954 Essential Splice Site 835 932 None 29
ENSDART00000129028 Essential Splice Site 835 932 None 28
Genomic Location (Zv9):
Chromosome 24 (position 24298857)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23545735
GRCz11 24 23690909
KASP Assay ID:
554-7076.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGACCGTCTTCAATCCTTTCATCATGGGTGGTCTGCTGATGTGGAAGG[T/G]ATGGCACTTACTGAACATAAAGTTTTGTTGGGGCTACTGTTTTATTTTAT
Long Flanking Sequence:
TTTTAACATTAAGAGTATTTTTTGTACTCTATCTTTATCGCTTATCTTTGTAATTATTATGCTTAGTATGAAACAGACATTAACAAGGTTTAATTTCTTATTTTTTTCAGCTCTCCTGCATTGATTTTGCCGAAAATATCGACATCACCAAAGTCCGTCAGCTGAGATTGGACGACATTCGGAAATCTTACTTTTTTGCATCCTTTTACTTTAGACTATTTGATTTTTGTGTTTTGGATTTGCTGAAATATTTAAAATGTGTACAACCCTTAACAGTATAAATAGGTGTTTTTCATAATAATTGCATTCTTCGGCTGTGGAAATATTGCATCTATCAACAGGTAAACTGCTTGTTTGCAATTAACACAGTACTACAGTATGAATCACATTCAAGTTTAATAATGCCTTCATCTACCCTCAAAGTTTTGATCCAGCGTCAGTGTATTGCTTTCTGACCGTCTTCAATCCTTTCATCATGGGTGGTCTGCTGATGTGGAAGG[T/G]ATGGCACTTACTGAACATAAAGTTTTGTTGGGGCTACTGTTTTATTTTATGCTGTTAAATTCTCTTTCAGGTTTTAATCCCATTTGTAATTGTGATGTGCACATTCGAAAGCATTCAAGTGTCAACGCAGCTCTCCTCACGAAGGTACTTTAAATTACAGAATTAGCATAGCAGGAAACAAAAATGTTTTATTTTTCTTCTTAAAGCATTTGATGTTTTAGTTCAAGCCTTCATGTTCACTTCCTTGAATTATTGCAAATATCAGGTTGTATATGTCAAGTATTTGCAAAACAAATAAACTAAAGTCCAACATGGAAAACTTCCCTAAATAGAACTAAATATAAGCTCAATATTGATTTGTGTATTGTATAGTTTTAGGGTCTTATTTTGCATATGTTCACATATAATCTGCATTTTATTTTCTAGTCTTTTCCTCATCGTACTTGTCATATCAGACTTGATGGCATTGGTAAGTTTGGTTTAGAGAAAACTGTAGCAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30097
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004013 None None 681 27 28
ENSDART00000084954 Nonsense 884 932 28 29
ENSDART00000129028 Nonsense 884 932 27 28
Genomic Location (Zv9):
Chromosome 24 (position 24298251)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23545129
GRCz11 24 23690303
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAACCGTTTATCTTTTTCACCAGCACTTCTTCTTCTTAGTTAAAGATTAT[G/T]GAAGCTGGCTTGACATAGGGACTAGGTAGGTTAATTGTATTATATTTCAG
Long Flanking Sequence:
CGAAAGCATTCAAGTGTCAACGCAGCTCTCCTCACGAAGGTACTTTAAATTACAGAATTAGCATAGCAGGAAACAAAAATGTTTTATTTTTCTTCTTAAAGCATTTGATGTTTTAGTTCAAGCCTTCATGTTCACTTCCTTGAATTATTGCAAATATCAGGTTGTATATGTCAAGTATTTGCAAAACAAATAAACTAAAGTCCAACATGGAAAACTTCCCTAAATAGAACTAAATATAAGCTCAATATTGATTTGTGTATTGTATAGTTTTAGGGTCTTATTTTGCATATGTTCACATATAATCTGCATTTTATTTTCTAGTCTTTTCCTCATCGTACTTGTCATATCAGACTTGATGGCATTGGTAAGTTTGGTTTAGAGAAAACTGTAGCAAAATGCTGAGTAAATCTTTTATCAGTGCAAAAAAACTCATTTTTAATGAAATTTTATTAACCGTTTATCTTTTTCACCAGCACTTCTTCTTCTTAGTTAAAGATTAT[G/T]GAAGCTGGCTTGACATAGGGACTAGGTAGGTTAATTGTATTATATTTCAGAAGATTTTAGCTAAAACTATCGTCTTTGGTGATCCTTATTAATGCAAGTTAGTGGCTGCATGAACATTGAGTGTCAAAAAACACATACAGGCAAACCAAAATGTATACCAATGGCTTCTGGGGTTTGTACCATGTAGCCAGATTAGCTAGATAAGGTTAGTATTTAGTGAAACCTTTTTCAAGATAACATCCACTGATAATGTATTTTACTGTTTTGACAATATATTTTAGATGATTTATACTTATTTTATTCATAATGCATCGGATATAATTTTTGTTTAATAACCAACAAGTTTAATTGTACAAATGTACAATGTAAATTTATATACATTATACATTTAAGTACAGTTGAAGTCAGAATTATTAGCCCCCTTTTTTATTTATTTTTATTTTTTTTAAATATTTTTCAAACTATGTTTAACAGGGCAAGGAAATTTTCATAGGATGTCT
Associated Phenotype:
Not determined