Busch Lab

ZMP

bat3l

Ensembl ID:
ENSDARG00000077531
ZFIN IDs:
ZDB-GENE-060307-2, ZDB-GENE-060825-176
Description:
hypothetical protein LOC751663 [Source:RefSeq peptide;Acc:NP_001038845]
Human Orthologue:
BAT3
Human Description:
HLA-B associated transcript 3 [Source:HGNC Symbol;Acc:13919]
Mouse Orthologue:
Bat3
Mouse Description:
HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30712 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32248 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30712
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088760 Essential Splice Site None 156 2 4
ENSDART00000135128 None None 1160 None 23
Genomic Location (Zv9):
Chromosome 19 (position 31755672)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30922961
GRCz11 19 30510274
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTAATCATTTTTAGAAACTTTTTCCATCTTCTCACCTTTTAAAA[G/T]AAATTTTGGAGGTCATGGAGGAATCAGGAGTCATAGAGGTGACCGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32248
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088760 Nonsense 27 156 3 4
ENSDART00000135128 Nonsense 27 1160 2 23
Genomic Location (Zv9):
Chromosome 19 (position 31755078)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30922367
GRCz11 19 30509680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATTTTGTTGCTGTTAATGTTTTGGATGTCACCTTTCTTACTTTCAGTG[G/A]ACAGTGAAGCAGTTTAAGGAGCACATCGCTGCTTCTGTTGAAATCTCTGT
Associated Phenotype:
Not determined