Busch Lab

ZMP

ahctf1

Ensembl ID:
ENSDARG00000077530
ZFIN ID:
ZDB-GENE-070521-2
Description:
Ahctf1 protein [Source:UniProtKB/TrEMBL;Acc:A5D6S7]
Human Orthologue:
AHCTF1
Human Description:
AT hook containing transcription factor 1 [Source:HGNC Symbol;Acc:24618]
Mouse Orthologue:
Ahctf1
Mouse Description:
AT hook containing transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1915033]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa23014 Nonsense Available for shipment Available now
sa9115 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa664 Nonsense F2 line generated Not yet available
sa32129 Nonsense Available for shipment Available now
sa28817 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4699
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Essential Splice Site 125 2527 2 35
Genomic Location (Zv9):
Chromosome 17 (position 12104590)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12087112
GRCz11 17 12241178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATCTCGGTATCTCTCGTGTTGTCAAGGCTGTGGTAATTCCAGGCAGAG[T/A]GAGTGCAGTTTTATTTCTGTGTTTTTCAGATGCTATTACAGTTTCATTAA
Long Flanking Sequence:
CAGCAGCTTGCTGCGCTTTCCAGAGGTGACGATAGATGCTCTGGGGGAGGATGAAGTTACTCTGGACTCTGTGCTGCACGGAAAATTTACTGTTGGTGAGTGTTGTTTTACACCGTTCTGATGGTCACTTGATTGCATCTATGAACACATGGCATGTTGTGTGAGATTTTTGATGTACGTTTCTTGGGTTACTATTAGATGTCTCCTCTTGTGTTTCATTAACATCTCTTATTTAATGGGTGCAGGGAAGAGTGGACTGGCCTGGCTGGCCTGCGGGCCTCAGTTGGAGGTTGTCCATGCTGTTAGTGGAGAGCGTTTCTCTGCTTACCACTTCAGCGGGGTGTCTGAACACCCTCCCACAGTTCTGGCTGTGAGGGACTTCTGCTGGCTGAAGCGAACAGGACTTCTTATTGGTCTGGAGGAAGCGGAGGGCAGCATGTTGTGTCTGTATGATCTCGGTATCTCTCGTGTTGTCAAGGCTGTGGTAATTCCAGGCAGAG[T/A]GAGTGCAGTTTTATTTCTGTGTTTTTCAGATGCTATTACAGTTTCATTAATATTTTGATTGTTTTTATCTGTAAATGTTTTTAGGTGTTAAATGTTGTCATTTTTACTTTACTTAAAAAAATATTTAACACTATTATAAAGTCAATCTTAACGCAAATGTTTCCTTTAATTCAACTTATCGTATATTTTAATTGTTAAACTTTTTTTAATGGTTTGTACTTGCTATAATCTCTTTGAATGTGTGCAAACTGATTTATCTGTTGACGAATCCTTTATATAAATAAAATTTTACAAAACACATCAACCTGGCATAAAGTGTTTTCTTTAATATTGTTTTATAAAGACACTACTGCTAAGGATCATGTGATTTGAAAAGAGCTTCTGCTTCTTCATAGATCACAACCATTGAGCCTCTGGTCAGTTATGGAGGGGCCAGCGCCAGCACACAGCATCTACACCAGAGTCTGCGCTGGTTTTTTGGTGTGGCTGCTGTGGTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23014
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 416 2527 8 35
Genomic Location (Zv9):
Chromosome 17 (position 12100512)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12083034
GRCz11 17 12237100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGTATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCAT[T/A]GAGGTCAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGACATGT
Long Flanking Sequence:
GGAGAGGAAGTGCTTGGCTTCAGGAAAAATTATTTATGAGGTACAGTGGCATGCAGAATTCTGAATGCTGCAAGTCTTTATGTTTGTTATGTTCTTGCAGAAAAAGATTCATTCTCAATGTGCTGACTTTTAGGGTCTGGAGTATTGTGAAGAACGTTACAGTCAGGACTTGAACGGTACATCATTTCCTCTAAGAGCTCAGGCCACCAATACCCGTCTGATCAGCTGTCAGACCATAGAGAAGTTTCGTCACCATCCTGACCGTGACGACAGCATGAATGAAGGTATTTACATGTCAAACACCACATGCTTTGCAGAGATTGATTGACTGATGTCACATTACCTTTAACTTTCAATTTGATTCTTTTTAGTGGCGTCTCCTGATACAAGTGTGTCAGTTTTCAGCTGGCAAGTGAAATCATATGGACAAGGCCAGCCATCAACATTCATAGGTGTATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCAT[T/A]GAGGTCAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGACATGTTGCATGTTGATGCATGTAAATAAATGCAAGCTTGCATCAAAGGCGTTTTTTCTTGTACAGAACGGGTGAATCCTTACGGAACTGTCCCTATCTGGCGGTCTGGTCTCTTGACTGTGTGATTGAGATGACAGCGCCCTGTGCTTTGTTGGACATCTTGGTTCATGAGCGCAGTCTAAGCAGAGGTCTCCCCTATACATGTCCTCCACCAGAACAGTTCTTCAATCCCACCACATACAACTTTGGCAAGACCTTTTCTTTATTTCATAATTTGCATGTTTGTGTTGTATAATTCCATTTGAATTCTAATAATATTACTCTTTCTATTCTAGATGGAAGTTGTTTGTTTAATGCTGGAATTGTGCACTTTACTTGCTCTGGCTATCAGAAAGAGGTTCGATTTTGGCCCATTCTGTACTAAATTGTGTTGAATTTTTATTTATTGTTTAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Essential Splice Site 417 2527 8 35
Genomic Location (Zv9):
Chromosome 17 (position 12100507)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12083029
GRCz11 17 12237095
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCATTGAGG[T/G]CAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGAYATGTTGCAT
Long Flanking Sequence:
GGAAGTGCTTGGCTTCAGGAAAAATTATTTATGAGGTACAGTGGCATGCAGAATTCTGAATGCTGCAAGTCTTTATGTTTGTTATGTTCTTGCAGAAAAAGATTCATTCTCAATGTGCTGACTTTTAGGGTCTGGAGTATTGTGAAGAACGTTACAGTCAGGACTTGAACGGTACATCATTTCCTCTAAGAGCTCAGGCCACCAATACCCGTCTGATCAGCTGTCAGACCATAGAGAAGTTTCGTCACCATCCTGACCGTGACGACAGCATGAATGAAGGTATTTACATGTCAAACACCACATGCTTTGCAGAGATTGATTGACTGATGTCACATTACCTTTAACTTTCAATTTGATTCTTTTTAGTGGCGTCTCCTGATACAAGTGTGTCAGTTTTCAGCTGGCAAGTGAAATCATATGGACAAGGCCAGCCATCAACATTCATAGGTGTATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCATTGAGG[T/G]CAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGACATGTTGCATGTTGATGCATGTAAATAAATGCAAGCTTGCATCAAAGGCGTTTTTTCTTGTACAGAACGGGTGAATCCTTACGGAACTGTCCCTATCTGGCGGTCTGGTCTCTTGACTGTGTGATTGAGATGACAGCGCCCTGTGCTTTGTTGGACATCTTGGTTCATGAGCGCAGTCTAAGCAGAGGTCTCCCCTATACATGTCCTCCACCAGAACAGTTCTTCAATCCCACCACATACAACTTTGGCAAGACCTTTTCTTTATTTCATAATTTGCATGTTTGTGTTGTATAATTCCATTTGAATTCTAATAATATTACTCTTTCTATTCTAGATGGAAGTTGTTTGTTTAATGCTGGAATTGTGCACTTTACTTGCTCTGGCTATCAGAAAGAGGTTCGATTTTGGCCCATTCTGTACTAAATTGTGTTGAATTTTTATTTATTGTTTAGTTAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa664
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 468 2527 9 35
Genomic Location (Zv9):
Chromosome 17 (position 12100250)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12082772
GRCz11 17 12236838
KASP Assay ID:
554-0572.1 (used for ordering genotyping assays)
KASP Sequence:
ATGAGCGCAGTCTAAGCAGAGGTCTCCCCTATACATGTCCTCCACCAGAA[C/T]AGTTCTTCAATCCCACCACATACAACTTTGGCAAGACCTTTTCTTTATTT
Long Flanking Sequence:
CGTGACGACAGCATGAATGAAGGTATTTACATGTCAAACACCACATGCTTTGCAGAGATTGATTGACTGATGTCACATTACCTTTAACTTTCAATTTGATTCTTTTTAGTGGCGTCTCCTGATACAAGTGTGTCAGTTTTCAGCTGGCAAGTGAAATCATATGGACAAGGCCAGCCATCAACATTCATAGGTGTATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCATTGAGGTCAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGACATGTTGCATGTTGATGCATGTAAATAAATGCAAGCTTGCATCAAAGGCGTTTTTTCTTGTACAGAACGGGTGAATCCTTACGGAACTGTCCCTATCTGGCGGTCTGGTCTCTTGACTGTGTGATTGAGATGACAGCGCCCTGTGCTTTGTTGGACATCTTGGTTCATGAGCGCAGTCTAAGCAGAGGTCTCCCCTATACATGTCCTCCACCAGAA[C/T]AGTTCTTCAATCCCACCACATACAACTTTGGCAAGACCTTTTCTTTATTTCATAATTTGCATGTTTGTGTTGTATAATTCCATTTGAATTCTAATAATATTACTCTTTCTATTCTAGATGGAAGTTGTTTGTTTAATGCTGGAATTGTGCACTTTACTTGCTCTGGCTATCAGAAAGAGGTTCGATTTTGGCCCATTCTGTACTAAATTGTGTTGAATTTTTATTTATTGTTTAGTTAATTTCTTTCTCTTTCAGACCCTTTGCTACCTAAAGAAGGTGGCACCAAGTTTGGGGGACAGTATTTCTAATGGATACTCTCGCTGTCTCATGTCTGGCCTTCTGTCTTCTCGTCTGGCTGATGTCCAGCCCTCCAGTCTCTCCCAGGTAACACTTCCTTATTTAACATGATGCAAGTTTGCTTCATAGATTTCACTCGTATGCATCAGAATTTTGTAGTCACTTTATTTTAATGTGGAATTTTCATTTATTAACCAACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32129
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 1030 2527 23 35
Genomic Location (Zv9):
Chromosome 17 (position 12092877)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12075399
GRCz11 17 12229465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTAGCCATCGAACGAGCAAAACCGTACCAACACCCTACTTTGATTCAC[A/T]GAGGTAATGAAAGCTGTCATAAGCACTGGAAACTATTCGTAAAAAGTGCA
Long Flanking Sequence:
TAAAGTTACACAATTTTGCTTTTTTACTGTATTTTGGGTCATAAATACAGCCTTAGTGAGTAAAAAAAAGACATGAAATAGAAACAAACAGGATCACTAATTTGTTTTCATTTGAGTGCGTGTGTGTCTGTGTGTGCAGGAGTGTTTGCAACGGTTCCTTCAAAGCAACGGAGGTTTCCAGAATCGGGAGCTGCTCATGGTCCACTACCTCCAGCAGGCAAATTACGTGCCTGCTCTACAACTCAACCAGACACTCAAATTGAACTTAGCTGTATGTTCAGTATTTAGGTTCACTTATCATTGTATAAATGTTTACTTTCATCTGTTGTAATTGGCTATTTAAAACATTTCTAATTCAGGCTGATCGGGATCCTAAAATGAAGGAAAGGTCAAACACGAGGAACTCTATTCTCAATCAGTATGGAAAGGTTCTTCCACGGGTACAGCGAAAGTTAGCCATCGAACGAGCAAAACCGTACCAACACCCTACTTTGATTCAC[A/T]GAGGTAATGAAAGCTGTCATAAGCACTGGAAACTATTCGTAAAAAGTGCAACATGAGAGATACCCTTAATCTTCTTTCCACTAGTGAAAAGACCCCAGCCTCTTTCAACCGTAACCAAACGTTCAGCTTCTGAAAACGTGATGACCAGGGCAGCGTTTATTAATAATGTATACTCGAAGATTGAGGAAGTGTGGGCTGGCAATAACACCACTCCAGAGTCATCTCCTTTCAAAAGGTAGTATGCTTTCTTTTATCCACTTTGCCTTCATTTTCAGTTCATAAGTCTTAGTTTTATCCCCCAAACAAATGTCTTTTAATCTAAATCATTTTGTTTGGCTTTGCTATTCAGCCCCAAAGAGTCTGAGATGCAAGTGCCTAGCCGACATCCATCCTCTCCAGATCTGCCTGAGGCCTTTGTAGGAACTCCCATCAACAAGCTAACCAAGAGAATGTCCAGGTAAAATTGTTCCAAGAGAGGTTTTGGGGTGTTGTGATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28817
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 1303 2527 28 35
Genomic Location (Zv9):
Chromosome 17 (position 12091165)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 12073687
GRCz11 17 12227753
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGAGAGCAGGAGAATCCTGACGTAGAATCTGAGACTGGATCCTCTATT[A/T]AAGAAATCCCCTTAGCAGAGTCCACAAAAGTGCTTCCCACTCTCGTGCGA
Long Flanking Sequence:
ACGATCAATCACTCCTCCTCTCCGGCCCAAAGAGAGCCGCATTACCTTCATAGAGGATGCTGATTCTCCAGAAGCTCCCAAAGGCTCTGTTCACTGGAACAATGGGGTAATGTGCCTTTTCTACAATCAAATGTCTATCTAAAATCAGATCAATTGCATTTATTATCACTGTAAATATAATAATGTAAATAGTTATATACCTTTACATTTGTCAATTTGTATCTTGCATATTATAGAAGTCATACTCCATGAGCCCTACTTATTAAAACATTGGAACAATTTTAGCAAGAGTGATTAATGCTTTTGGTTCTCCACAGATTTCAGTTAACAGGGAGCACAATACTCCTAAGCGATCTTCTCCTCCTGCTAAAGCAAGCATTGGGGTCTGGAGTGAACATTCAGATGCTGAAGAGGAAGATGTAGATATGAAAATGACATGCATGCCCTCTCTGGGAGAGCAGGAGAATCCTGACGTAGAATCTGAGACTGGATCCTCTATT[A/T]AAGAAATCCCCTTAGCAGAGTCCACAAAAGTGCTTCCCACTCTCGTGCGACGGCCTAGTTTGGGGCAAGAAGCAAGTCTTGTATCCAACCAATCCGATACCACCCTTGAGTTTCATGATGCTCCTGCTCCCGAGGATCTTTTGATTACTCTGAAAGAGCAGCAAGCAAACAATAGTGTGGATCGAGAGGTGACAGTAAGACTTCCAAACACTTTTGAGGAACATACAGCTCCTGTAGAAAGGAACACAACTGTGGACTTGCCTTCTCTTATGCTGCCTGAGAAAGAAAAGGACAATTCAAGGGGAGACTTGTCCAATGCAGAGAGATCTTTAGGCATACAGGAAGCCCAAAATGAGGAGGAGTGTGTTAATATTACCAATGATGTTGTGGAGAACGTAAGCGAGGAGCAGCTAAAAGGAATTTCAGAGGCTCAGGTTCTCAAGATAGATGTGGTTATTAAACCAGAGTTGGTTGTTCCTGTTCAGGAACCAAGCTCTGAA
Associated Phenotype:
Not determined