Busch Lab

ZMP

LOC558743

Ensembl ID:
ENSDARG00000077514
Human Orthologue:
SLITRK1
Human Description:
SLIT and NTRK-like family, member 1 [Source:HGNC Symbol;Acc:20297]
Mouse Orthologue:
Slitrk1
Mouse Description:
SLIT and NTRK-like family, member 1 Gene [Source:MGI Symbol;Acc:MGI:2679446]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa44417 Nonsense Mutation detected in F1 DNA Not yet available
sa38206 Nonsense Available for shipment Available now
sa30416 Nonsense Mutation detected in F1 DNA Not yet available
sa24774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 7 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 162959)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 162959
GRCz11 1 4546246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTCGGGGATGATTGTGTCGTATTAAAAATGCTGCTTTGGATTGTGT[T/A]GCTGAAGGCGGCTCTTTGTGTAGCTATCGGGAATGTTACAAGGGACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38206
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 159 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 162503)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 162503
GRCz11 1 4546702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGACATCGACCCGTCTGTGTTCAGGGACTTGAGTAAGCTTGAAGTTT[T/A]AATCTTGAACGACAACCTTATTAGCGCTCTTCCCATCAACGTGTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30416
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 388 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 161817)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 161817
GRCz11 1 4547388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCACGAGTTAAATCTGCGCGACAACAACATTCACACCGTGAGAAGGAAC[C/T]AGCTTAGAGGCTACCATAGTTTAAACTTGCTCGATTTGGGGGGGAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 576 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 161251)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 161251
GRCz11 1 4547954
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAGGGATTTCCGCCGGATCAGGAATGATCTGATGTGCCCTCAGCTCTA[C/A]GACAAGATCTCCCCCACCTCTCTGTCCAAAAACAGCACTCTCCCTGCAGA
Associated Phenotype:
Not determined