Busch Lab

ZMP

tjp1

Ensembl ID:
ENSDARG00000077506
ZFIN ID:
ZDB-GENE-031001-2
Human Orthologue:
TJP1
Human Description:
tight junction protein 1 (zona occludens 1) [Source:HGNC Symbol;Acc:11827]
Mouse Orthologue:
Tjp1
Mouse Description:
tight junction protein 1 Gene [Source:MGI Symbol;Acc:MGI:98759]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa40924 Nonsense Mutation detected in F1 DNA Not yet available
sa7069 Nonsense Mutation detected in F1 DNA Not yet available
sa20982 Essential Splice Site Available for shipment Available now
sa13285 Nonsense Available for shipment Available now
sa34097 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40924
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 436 1699 10 29
ENSDART00000148347 Nonsense 361 1637 9 28
Genomic Location (Zv9):
Chromosome 7 (position 32439466)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30833806
GRCz11 7 31104956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGAGATGAGGAGCGCATCTCTAAACCAGCGGCTCTATCCACTCCAGTT[A/T]AGATGGCTGAGGATGCTCTTCTGGCTCCGCCCAGCGAACAGCCCGGGGAC
Long Flanking Sequence:
AAGCCTTTAAATTGCACTTTAAGCTGAACACTAGTATCTTGAATAAATATATAGTAAAATATTATTTACTGTCACCATGGCAAAGATAAAAGAAGTCAGTTATTAGAAATGAGTTATTAAAACTATTAAATTTGGAATATTTACACAGAAATTGGCGAAGAATATAAAATAATTAATATTTAACTGAAGGGCCAATAATTCTGACTTCAACTGTAGACTTTCAGTCAAAAGTACCTGCATAATGTTCTGTTATTAGTTGTCCGTGCCTGTAGCCCGATGAATACATTTAGACGTTGGTCAAGTAATATACACATGAAACTAAAATCTGCCTTGTACAGTGCAACCTAAAATATTATTATTATTTTTGTTTAAATAAAGTACATGTTCATGTTTGTCTACTACAAAGCTTATTTCTGACTGTGATCTGCGCATTTGCCTGCAGCCATAGAAGTCGAGATGAGGAGCGCATCTCTAAACCAGCGGCTCTATCCACTCCAGTT[A/T]AGATGGCTGAGGATGCTCTTCTGGCTCCGCCCAGCGAACAGCCCGGGGACAAACAGATCCCTCCACTGCCAGGTCTGGACTTTCAGCTGTCTTCTGTCTTTCCCGTTGCTCTCTCATTGGCATGCGAAGGACCTCTTAAAATATATGATGAGGCAATTCACATCTCTCTGTTTTCTTATTTACTCTATTTTCCTTTTTTTTTAAGGTGCAATTTCATGTGAGGTCATCTTAATTTACAAGTAAAGGCATATTATGATCATGCAGCCAATACAGTGTTAGTTTTAATGTTTAAATATTATATTAACTCAATAATAATGAAAAAATTCATAGAACGTTAGAATGAAATCCAAACAGGCATTTTTCTCATAAGTAGAATATTGTAATGCTCTTTATAAGGGATATAAAACTCAACCAACGTTCTATCAATGATATCTCTTCTCTAATTACACGTTCACTAGCTTAAGGGTAGGAAAAACCTTTACCTCACAAATGATTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7069
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 449 1699 10 29
ENSDART00000148347 Nonsense 374 1637 9 28
Genomic Location (Zv9):
Chromosome 7 (position 32439505)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30833845
GRCz11 7 31104995
KASP Assay ID:
554-5211.1 (used for ordering genotyping assays)
KASP Sequence:
CCACTCCAGTTAAGATGGCTGAGGATGCTCTTCTGGCYCCGCCCAGCGAA[C/T]AGCCCGGGGACAAACAGATCCCWCCACTGCCAGGTCWGGACTTTCAGCTG
Long Flanking Sequence:
TGAATAAATATATAGTAAAATATTATTTACTGTCACCATGGCAAAGATAAAAGAAGTCAGTTATTAGAAATGAGTTATTAAAACTATTAAATTTGGAATATTTACACAGAAATTGGCGAAGAATATAAAATAATTAATATTTAACTGAAGGGCCAATAATTCTGACTTCAACTGTAGACTTTCAGTCAAAAGTACCTGCATAATGTTCTGTTATTAGTTGTCCGTGCCTGTAGCCCGATGAATACATTTAGACGTTGGTCAAGTAATATACACATGAAACTAAAATCTGCCTTGTACAGTGCAACCTAAAATATTATTATTATTTTTGTTTAAATAAAGTACATGTTCATGTTTGTCTACTACAAAGCTTATTTCTGACTGTGATCTGCGCATTTGCCTGCAGCCATAGAAGTCGAGATGAGGAGCGCATCTCTAAACCAGCGGCTCTATCCACTCCAGTTAAGATGGCTGAGGATGCTCTTCTGGCTCCGCCCAGCGAA[C/T]AGCCCGGGGACAAACAGATCCCTCCACTGCCAGGTCTGGACTTTCAGCTGTCTTCTGTCTTTCCCGTTGCTCTCTCATTGGCATGCGAAGGACCTCTTAAAATATATGATGAGGCAATTCACATCTCTCTGTTTTCTTATTTACTCTATTTTCCTTTTTTTTTAAGGTGCAATTTCATGTGAGGTCATCTTAATTTACAAGTAAAGGCATATTATGATCATGCAGCCAATACAGTGTTAGTTTTAATGTTTAAATATTATATTAACTCAATAATAATGAAAAAATTCATAGAACGTTAGAATGAAATCCAAACAGGCATTTTTCTCATAAGTAGAATATTGTAATGCTCTTTATAAGGGATATAAAACTCAACCAACGTTCTATCAATGATATCTCTTCTCTAATTACACGTTCACTAGCTTAAGGGTAGGAAAAACCTTTACCTCACAAATGATTGCAACAACAGCAAATGACAACAATCCAGCATTTCAGTTAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20982
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Essential Splice Site 655 1699 14 29
ENSDART00000148347 Essential Splice Site 580 1637 13 28
Genomic Location (Zv9):
Chromosome 7 (position 32446437)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30840777
GRCz11 7 31111927
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAAGAACCACCAGGAGGTGGAAAGAGGCATCATTCCCAACAAGAACAG[G/C]TGATCCTACTATAATGCATCAACAGTAAATAGACAACCTTCAGCTATTGT
Long Flanking Sequence:
CAAAAAACCCTCTTGAGAAATGTTTTTATTTAATGTCCCCCTCTGAGCAGCTTCAGCTCTCACCAGGGAAATTAATAATTTTACTCTCGGTGGGGCTTGGGCAAGGGGGTGCTCAATGGAAACCTCCTAGTTTGCCTGTGCCTAGAAACGGATATCTTTCAGTAGTAATTACTAAAATAATTGTTTTTTTTCCCACCCCACTATGTAGACCGTTTTGGCCTTTATAAGATCAAAAATGATTACTTCTTCATTACCGTCTTGTTTATCCCCTGTCCTCCAGTGTACCGGCGAATAGTGGAGTCTGATGTGGGCGACTCCTTCTACATCAGGACACACTTTGAGTACGAGAAAGAGTCTCCTTATGGGCTGAGCTTTAATAAAGGAGAGGTGTTCAGAGTGGTGGACACTCTCTACAATGGCAAACTGGGCTCCTGGCTGGCTATCCGCATCGGGAAGAACCACCAGGAGGTGGAAAGAGGCATCATTCCCAACAAGAACAG[G/C]TGATCCTACTATAATGCATCAACAGTAAATAGACAACCTTCAGCTATTGTATATGATATCATTATTTTGTGTAGATCCTATATTGATCATTGTTTTAGTTCCTAAAAAGAGCGGAGAATCAAAAATGAGTATACATCTGACCTGGTGTTGCCATCTTCTCTTCAGGGCGGAACAGTTATCAAGCGTACAGTACACACTCCCCAAGACTGCAGGTGGTGATCGTGCTGATTTCTGGAGGTTCAGAGGCCTGCGCAGTTCAAAGAGGAACTTGCGCAAGAGTAGAGAAGATCTGTCAGCTCAGCCCGTTCAGACCAAGTTCCCTGCTTATGAAAGGGTGGTTCTTAGAGAGGGTATGTGTGTAGATAAGAGTGCACAATATATGTTTTATGTTAGCTTTTTTTAGGACCAGTATTGAATATATACAGTAGGCAACTTTTGAAATGAATCAAAACCTCTCATCAGGTTGTCTGTCCTTAAACTATTAAAAAGCACCCATTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26976
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 1098 1699 22 29
ENSDART00000148347 Nonsense 1023 1637 21 28
Genomic Location (Zv9):
Chromosome 7 (position 32460145)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30854485
GRCz11 7 31125635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCCTATGCAGCCCAACTACTACCAGGAAGACAAGCCATACAGAGATTA[T/A]GACCACCAGCCCTACCGCTATGATGGAGGCTACATGGAACCAAAGGCTCG
Long Flanking Sequence:
ATGGTTCCTAAAAGGCTACTTCTCAAAATATAATTTTTTGTTATTTGGAGCAAATTACTTTTGGTATTTTTCCCCTTTTCAGTGAGACTTTTGCTGGCTGATTCTCCCCAGTGTTTTTCGCAGCTTGGCGTGTCATAAGTCATTTAAACTCTCTCAAACTCTGAAACTGTCTGTGTGATGGCTGCCTCCATTTTTGACCTGTTCAATAACTGCCCACTCTTGAGTCTTCCTCTATTGCAGGTCTCTCTTCTGACTCTCTGCTTCATTCTTCAACTTTTAATCCGAATATTAATCACTTCTGGTTTCTGCCGTTTCATTCAATTCAATTGATTGCTGTGGTTTATGCATGTTATTTATGCAGTTTCACTTACAACTCTCCTCATTTGGCTTGATCGACAGATGTACAAGAAGGATATCTACCGACCCAACGAACCGGTGCAGATAAGCCAAAACCCTATGCAGCCCAACTACTACCAGGAAGACAAGCCATACAGAGATTA[T/A]GACCACCAGCCCTACCGCTATGATGGAGGCTACATGGAACCAAAGGCTCGTAACTTTGACCCACATTTTGAGGACAGCGTGCCTCCATATAATGATCAATGGGGTCAGTATGACCACACCTCTGGGTATGAACCTCAAACGCTCTACGAGGATGGTCTGAACCGCTTGTATGGTCACCCTCAGTCACGAAACGACACCGGCTACGACACAGGTCGACCTCGATATGGCAAACCAACCTCTGGACCAATCCGACACGATGAACCACCACCATCACGCCCACAATATGACACTCAACAAACCTCTCGTTCCCCAGAACCGCCCAAACAACAATACTACGACCCTTCCCAAAGGCCTTCCTACACTCAAGCTCCACAAAAAGGCTATATGAACTCTGAAGCACCGGTAACGCCACCCAAACCTGAGTCGCTCTCACCGCCTTTGGAGCCTGCTCTTCCTCCTCCACCTCCTCCAGCCGAAGCAGAGGATGATCCCGCCATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13285
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 1172 1699 22 29
ENSDART00000148347 Nonsense 1097 1637 21 28
Genomic Location (Zv9):
Chromosome 7 (position 32460365)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30854705
GRCz11 7 31125855
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGTCACCCTCAGWCACGAAACGACACCGGCTACGACACAGGTCGACCT[C/T]GATAYGGCAAACCAACCTCTGGACCAAWCCGACACGATGAACCACCACCA
Long Flanking Sequence:
TGAGTCTTCCTCTATTGCAGGTCTCTCTTCTGACTCTCTGCTTCATTCTTCAACTTTTAATCCGAATATTAATCACTTCTGGTTTCTGCCGTTTCATTCAATTCAATTGATTGCTGTGGTTTATGCATGTTATTTATGCAGTTTCACTTACAACTCTCCTCATTTGGCTTGATCGACAGATGTACAAGAAGGATATCTACCGACCCAACGAACCGGTGCAGATAAGCCAAAACCCTATGCAGCCCAACTACTACCAGGAAGACAAGCCATACAGAGATTATGACCACCAGCCCTACCGCTATGATGGAGGCTACATGGAACCAAAGGCTCGTAACTTTGACCCACATTTTGAGGACAGCGTGCCTCCATATAATGATCAATGGGGTCAGTATGACCACACCTCTGGGTATGAACCTCAAACGCTCTACGAGGATGGTCTGAACCGCTTGTATGGTCACCCTCAGTCACGAAACGACACCGGCTACGACACAGGTCGACCT[C/T]GATATGGCAAACCAACCTCTGGACCAATCCGACACGATGAACCACCACCATCACGCCCACAATATGACACTCAACAAACCTCTCGTTCCCCAGAACCGCCCAAACAACAATACTACGACCCTTCCCAAAGGCCTTCCTACACTCAAGCTCCACAAAAAGGCTATATGAACTCTGAAGCACCGGTAACGCCACCCAAACCTGAGTCGCTCTCACCGCCTTTGGAGCCTGCTCTTCCTCCTCCACCTCCTCCAGCCGAAGCAGAGGATGATCCCGCCATGAAGCCCCAGTCGGTGCTCACCAGGGTGAAGATGTTCGAGAACAAGCGATCGGTGTCTGTAGACAGAGCCAGAGAGTCTGCAGACTCTGGTATTCGGGTGAGTTGATGGTCTGCATGTCTACTCACTAAATATACACTTGGGCTAAATAATTCATATGTTCATCTTTCTGCTTCCTGTAGCCTGTGGACATGGTGCCTAAACCTGGCGCTGCCTCCGTGCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34097
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 1223 1699 22 29
ENSDART00000148347 Nonsense 1148 1637 21 28
Genomic Location (Zv9):
Chromosome 7 (position 32460518)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30854858
GRCz11 7 31126008
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAACAATACTACGACCCTTCCCAAAGGCCTTCCTACACTCAAGCTCCA[C/T]AAAAAGGCTATATGAACTCTGAAGCACCGGTAACGCCACCCAAACCTGAG
Long Flanking Sequence:
CTCTCCTCATTTGGCTTGATCGACAGATGTACAAGAAGGATATCTACCGACCCAACGAACCGGTGCAGATAAGCCAAAACCCTATGCAGCCCAACTACTACCAGGAAGACAAGCCATACAGAGATTATGACCACCAGCCCTACCGCTATGATGGAGGCTACATGGAACCAAAGGCTCGTAACTTTGACCCACATTTTGAGGACAGCGTGCCTCCATATAATGATCAATGGGGTCAGTATGACCACACCTCTGGGTATGAACCTCAAACGCTCTACGAGGATGGTCTGAACCGCTTGTATGGTCACCCTCAGTCACGAAACGACACCGGCTACGACACAGGTCGACCTCGATATGGCAAACCAACCTCTGGACCAATCCGACACGATGAACCACCACCATCACGCCCACAATATGACACTCAACAAACCTCTCGTTCCCCAGAACCGCCCAAACAACAATACTACGACCCTTCCCAAAGGCCTTCCTACACTCAAGCTCCA[C/T]AAAAAGGCTATATGAACTCTGAAGCACCGGTAACGCCACCCAAACCTGAGTCGCTCTCACCGCCTTTGGAGCCTGCTCTTCCTCCTCCACCTCCTCCAGCCGAAGCAGAGGATGATCCCGCCATGAAGCCCCAGTCGGTGCTCACCAGGGTGAAGATGTTCGAGAACAAGCGATCGGTGTCTGTAGACAGAGCCAGAGAGTCTGCAGACTCTGGTATTCGGGTGAGTTGATGGTCTGCATGTCTACTCACTAAATATACACTTGGGCTAAATAATTCATATGTTCATCTTTCTGCTTCCTGTAGCCTGTGGACATGGTGCCTAAACCTGGCGCTGCCTCCGTGCCCAAAGCCAATTCTTTAAGTAACCTGGATCAAGAGAAGACCTTTAGGTAATGAGCTTGAGTATGAAGTATAAATCAGTGTGTTAGAATAAATGAGCATTGGTGTCTATTTAAAGGACACACATTTAAGCACACACGCATATCATTTTATAACATGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26977
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 None None 1699 None 29
ENSDART00000148347 Essential Splice Site 1607 1637 27 28
Genomic Location (Zv9):
Chromosome 7 (position 32468197)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 30862537
GRCz11 7 31133687
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCCCTGATGGTTGGTCTTTTGCTCTAAAATCCTCCGACTCCTCGTCGGG[T/C]ACGCTGTCCTCTCTCTGTCCTTTTGGGTTCGTTTGGGATGGCTTTGTGAC
Long Flanking Sequence:
ACCACATGTTTTTGAACATGACTTTAAAACATTGCATATAAATTTTCATTAAACATTTAAACAGGCACTGACAGTGCAAATAAGAATGCTAAGCCAGAGTTTAGGAATATACAGGGAAAATCATCAGTATATAAATACCCAAGAATAAATAATAACCTCAAGTAAATCATACCAAAAGTAGTGTAAAGTTTTAACAAGATAAGCCAAGATTCTTTTACCTGGTGTTCACAATCCCCAAGGGTTACTGTAACTACTTTAAGTGTGCAGTACCTTGTCTTTCTGTCTATTTTCTACTTGATACTTGATGTTAAGTTTCTGAGTAGACTCATTTCTGTATTTTGTATTGTCTTTGCAGGAGAAACTCTGTTGAGTCCTCTGGTGATGTGTGGTCCTCACGGTCTGAAATTCCTGAAGCCAGTGGAGCTCCGCTTACCTCACTGTGCGTCTATGACCCCTGATGGTTGGTCTTTTGCTCTAAAATCCTCCGACTCCTCGTCGGG[T/C]ACGCTGTCCTCTCTCTGTCCTTTTGGGTTCGTTTGGGATGGCTTTGTGACATCTTGTGTGATCATGGGTCTTTTTTCATCATTATGTATTTTCTTTTTCATGCCTCCAAATCATTTGTTTACACATTTTTTATTATTTATTTAATTAGTCATTGTTAACATACATCATTCACTCACTCCAGCCTGTTCATTCATGTGTGTTTTTTTAAATCCATGTGTCAGTTTTAACCCTAAAACAGATGTGAAAATTCACCTTAACATCCAGGTCATGCTCTTTTAGCAATATTAAGTAGTCGGTGGTTAATAAGATTTTTTCCCCAGAAGAAATTTAAGTTTAATTATAATAATAGTACAAAATATTTTGTTTCCCAGTAAACAGTGATATTTTTTTATTCTTATTAATCAAAAAATCCTAAAAAAAGAAAAGAAAAAAAATTACAAATGTAAGTAGACTGAACAAAAAACAATTAAGTTAACTTAATCAATTTGTGTTGGGAGAAC
Associated Phenotype:
Not determined