Busch Lab

ZMP

atp8a2

Ensembl ID:
ENSDARG00000077492
Human Orthologue:
ATP8A2
Human Description:
ATPase, aminophospholipid transporter, class I, type 8A, member 2 [Source:HGNC Symbol;Acc:13533]
Mouse Orthologue:
Atp8a2
Mouse Description:
ATPase, aminophospholipid transporter-like, class I, type 8A, member 2 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa18573 Essential Splice Site Available for shipment Available now
sa24493 Essential Splice Site Available for shipment Available now
sa39447 Nonsense Mutation detected in F1 DNA Not yet available
sa16737 Essential Splice Site Available for shipment Available now
sa25213 Nonsense Mutation detected in F1 DNA Not yet available
sa18465 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18573
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 169 1189 5 36
Genomic Location (Zv9):
Chromosome 24 (position 22062921)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21309799
GRCz11 24 21454973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTTYCAGTTCTGCGTAACGGAGCATGGCAGACCATCATATGGAARCAG[G/A]TAACCCTGTCTTTTGCTCTTTTCCTGCATCTGTTATTCCYCTTTTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24493
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 422 1189 12 36
Genomic Location (Zv9):
Chromosome 24 (position 22056285)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21303163
GRCz11 24 21448337
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCCCGCTATGGCTCGAACGTCCAATCTGAATGAAGAACTCGGCCAAG[T/C]AAGAAAACACATTTACAAATGTTTATCTACCTCATCTCCATTACATCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39447
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Nonsense 430 1189 13 36
Genomic Location (Zv9):
Chromosome 24 (position 22056188)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21303066
GRCz11 24 21448240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACCCACACTCTTCCTCTTTTTTCCAGGTAAAATATCTATTTTCAGAT[A/T]AAACCGGCACTCTCACCTGCAACGTCATGCACTTTAAGAAGTGCACGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16737
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Essential Splice Site 624 1189 21 36
Genomic Location (Zv9):
Chromosome 24 (position 22049872)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21296750
GRCz11 24 21441924
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAKTTACTTGTAGTGTTTTGCCTTATGATTATTATTRTTRTTATCATTTC[G/A]CATKTGCAGGGCTGAGGACACTGTGTTTTGCGTATGTGGATCTCGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25213
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Nonsense 668 1189 21 36
Genomic Location (Zv9):
Chromosome 24 (position 22049738)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21296616
GRCz11 24 21441790
KASP Assay ID:
554-7695.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTATTAGCACTGTGTTAAAGGACCGAGCACAGAAACTGGAGGAGTGTTA[C/A]GAACTCATAGAGAAGGTATGTACTGTAATATATGCCATGTATGTCTAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18465
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109848 Nonsense 1048 1189 32 36
Genomic Location (Zv9):
Chromosome 24 (position 22000158)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21247036
GRCz11 24 21392210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTRGCTGTCTGGGGCAGCATGGTGCTTTGGATGCTGTTTTTTGCCGTCTA[T/A]TCTGCGATCYGGCCAACTATTCCTATAGCTCCRGATATGTTRGGCCAGGT
Associated Phenotype:
Not determined