Busch Lab

ZMP

LOC558484

Ensembl ID:
ENSDARG00000077489
Human Orthologue:
LRFN2
Human Description:
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
Mouse Orthologue:
Lrfn2
Mouse Description:
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa3080 Nonsense F2 line generated Not yet available
sa23611 Nonsense Available for shipment Available now
sa39263 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa3080
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 69 781 1 2
Genomic Location (Zv9):
Chromosome 20 (position 87831)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 78426
GRCz11 20 67061
KASP Assay ID:
554-3091.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGTACCGTGGAGCTCCGGCTGGGKGGAAACTTCATCCTGCGAATCACA[C/T]AGCAGGACTTTGCCAACATGACAGACCTAGTGGACCTTACGCTCTCYCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23611
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 322 781 1 2
Genomic Location (Zv9):
Chromosome 20 (position 88591)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 79186
GRCz11 20 67821
KASP Assay ID:
2261-3788.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCTGCGGTGCGATGCCATCGGAGATCCCATCCCTACCATACACT[G/A]GGTCACCCCTGAAGATCGATTGCTGGGAAACTCTTCTCGCACAGTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39263
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114999 Nonsense 373 781 1 2
Genomic Location (Zv9):
Chromosome 20 (position 88743)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 79338
GRCz11 20 67973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTCACTTGCATTGCAGCCAACCTGGCTGGCGAATCAACAGCTTCCGTG[G/T]AGCTGTCAATTATTCAGCTGCCTCACATAAGCAACGGCACAGGACAGGCA
Associated Phenotype:
Not determined