Busch Lab

ZMP

LOC100004230

Ensembl ID:
ENSDARG00000077465
Human Orthologue:
SORCS2
Human Description:
sortilin-related VPS10 domain containing receptor 2 [Source:HGNC Symbol;Acc:16698]
Mouse Orthologue:
Sorcs2
Mouse Description:
sortilin-related VPS10 domain containing receptor 2 Gene [Source:MGI Symbol;Acc:MGI:1932289]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11642 Nonsense Available for shipment Available now
sa21038 Nonsense Available for shipment Available now
sa31584 Nonsense Available for shipment Available now
sa31585 Nonsense Available for shipment Available now
sa21039 Nonsense Available for shipment Available now
sa7079 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11642
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 424 1133 10 27
Genomic Location (Zv9):
Chromosome 7 (position 41408230)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39744487
GRCz11 7 40015504
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCAGGTTCGTGGAGTCAAGGGCGTTTTCTTAGCCAATCAGAAAGTAGAT[G/T]GAAAAGTAATGACTCTCATCACCTACAACAAAGGCAGAGACTGGGAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21038
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 432 1133 10 27
ENSDART00000111278 Nonsense 432 1133 10 27
Genomic Location (Zv9):
Chromosome 7 (position 41408256)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39744513
GRCz11 7 40015530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTAGCCAATCAGAAAGTAGATGGAAAAGTAATGACTCTCATCACCTA[C/A]AACAAAGGCAGAGACTGGGAAGCGCTCGCTCCCCCTGCAACTGATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 432 1133 10 27
ENSDART00000111278 Nonsense 432 1133 10 27
Genomic Location (Zv9):
Chromosome 7 (position 41408256)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39744513
GRCz11 7 40015530
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTAGCCAATCAGAAAGTAGATGGAAAAGTAATGACTCTCATCACCTA[C/A]AACAAAGGCAGAGACTGGGAAGCGCTCGCTCCCCCTGCAACTGATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 671 1133 17 27
Genomic Location (Zv9):
Chromosome 7 (position 41428785)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39765042
GRCz11 7 40036059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAATAGAGCTTTACATCTCTCACTTTCTGTGTGTGTTCTCAGTGACTA[T/G]GGCTTTGAGCGAGCTCCCAGTCTCAGGTTAGAGGGGGATCGCTGTTATCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5436
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 675 1133 17 27
Genomic Location (Zv9):
Chromosome 7 (position 41428795)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39765052
GRCz11 7 40036069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTACWTCTCTCACTTTCTGTGTGTGTTCTCAGTGACTATGGCTTTGAG[C/T]GAGCTCCCAGTCTCAGGTTAGAGGGGGATCGCTGTTATCCGGACTTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21039
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Nonsense 777 1133 19 27
Genomic Location (Zv9):
Chromosome 7 (position 41434440)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39770697
GRCz11 7 40041714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATTGTATTTGTTTCACTCCTCAGGGTGACACCAGCAGCACCAGGTA[T/A]CAGGTGGATTTAATGGACGGGGTCAGGGCTATATATGAGAACCTGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7079
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111278 Essential Splice Site 1064 1133 26 27
Genomic Location (Zv9):
Chromosome 7 (position 41444173)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39780430
GRCz11 7 40051447
KASP Assay ID:
554-5204.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGCTGAGGCCAGAGGAGAGCAGCCTAACGCGTCCCTGGCTGCGTTTCA[G/A]AAAACTGCCAGGCAGAAACGTCTACGCTCAGATGCACAACGAGAAGGAGC
Associated Phenotype:
Not determined