Busch Lab

ZMP

KIAA2018

Ensembl ID:
ENSDARG00000077431
Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Human Orthologue:
KIAA2018
Human Description:
KIAA2018 [Source:HGNC Symbol;Acc:30494]
Mouse Orthologue:
Gm608
Mouse Description:
predicted gene 608 Gene [Source:MGI Symbol;Acc:MGI:2685454]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa44127 Splice Site Mutation detected in F1 DNA Not yet available
sa18018 Nonsense Available for shipment Available now
sa44128 Nonsense Mutation detected in F1 DNA Not yet available
sa24492 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30089
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Essential Splice Site 27 2104 2 11
Genomic Location (Zv9):
Chromosome 24 (position 21800775)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21047904
GRCz11 24 21192323
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTAAATTGTTAGGCGGAAGAAAAACAAGGAGATTCACAATGCAGG[T/A]AAGAAACAACTGATACAATTTACTAGTGTGATTCTTTTAACATATTATTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8037
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 176 2104 5 11
Genomic Location (Zv9):
Chromosome 24 (position 21803806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21050935
GRCz11 24 21195354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACAAGCAAAGTCTCTATTCCTCCTAGTCCAGTTTCCAATCTCGATAAA[C/T]AACCATCAAATGCTGYAACAKTCCAACCATCATGCGATATTTCATTGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44127
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Splice Site None 2104 None 11
Genomic Location (Zv9):
Chromosome 24 (position 21803852)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21050981
GRCz11 24 21195400
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAACAACCATCAAATGCTGTAACAGTCCAACCATCATGCGATATTTCAT[T/A]GGGCACCGGCCAGACTTTTGGTATTACGAATGGAGCACCAGTAAACAACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1416
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 207 2104 6 11
Genomic Location (Zv9):
Chromosome 24 (position 21804032)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21051161
GRCz11 24 21195580
KASP Assay ID:
554-1337.1 (used for ordering genotyping assays)
KASP Sequence:
GGAACAATATTCTCCTCTGGCACCTACTACTCCAAGGTTAAACCCTCCTA[T/A]GAATTATATTACTCTTCAAGGATTATGTCCCCAACCTGCTGTCAGCACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 381 2104 7 11
Genomic Location (Zv9):
Chromosome 24 (position 21804613)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21051742
GRCz11 24 21196161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCAGATATATTCGGCTGTTGTGCCRTGCCCTCAGGCAGCAGTAGCACAA[C/T]AGTCYTCAATTTTATCTGTSCCAGCCATTGTATCACAAGCTTTAGTAGTM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44128
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 942 2104 10 11
Genomic Location (Zv9):
Chromosome 24 (position 21806753)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21053882
GRCz11 24 21198301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTCAGGCATCATTTGATGCAACTTCAACTCCAGATTCAGACACTTCTT[T/A]GTCAACTCAACCTGTTCCCCTTTCAGAAACATCAAGGATTTCAGACCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24492
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111754 Nonsense 1061 2104 10 11
Genomic Location (Zv9):
Chromosome 24 (position 21807110)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 21054239
GRCz11 24 21198658
KASP Assay ID:
2261-8691.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACCTTTGGCAGGAGGTTCAGGTGGCAGAGGGTTTTCTGTTGCATCGT[T/A]GCTTCCAGCAGGCCACAACATCAGCGCTTCTTCAAGTACATTTGGTGCTT
Associated Phenotype:
Not determined