Busch Lab

ZMP

NP_001122261.1

Ensembl ID:
ENSDARG00000077414
Description:
hypothetical protein LOC794943 [Source:RefSeq peptide;Acc:NP_001122261]
Mouse Orthologues:
Csprs, Gm7592, Gm7609
Mouse Descriptions:
component of Sp100-rs Gene [Source:MGI Symbol;Acc:MGI:1891441]
predicted gene 7592 Gene [Source:MGI Symbol;Acc:MGI:3644077]
predicted pseudogene 7609 Pseudogene [Source:MGI Symbol;Acc:MGI:3644536]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa2380 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2380
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125594 Nonsense 74 323 1 2
Genomic Location (Zv9):
Chromosome 7 (position 21495392)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20085828
GRCz11 7 20337796
KASP Assay ID:
554-3207.1 (used for ordering genotyping assays)
KASP Sequence:
TCCGCGCTGGTTTACTTTGCGCTCTGCTTCAGCTTCTACTTACAAAACTA[T/A]CTGAATGCGGCCACCACGGCCACCACATGCACGGYGCTAATAAGAGGWCT
Long Flanking Sequence:
AAACGAGCACTCCTCCAACACGCCCTCTTGTTCTGCTTCTAGAGAGGGAAGTAAACGTGAGCTCGTCTTTTTCTTCCATCACTAGACCGACTTTTATGATAAGTAACGCAGGGGATTCTGACCGAAACAGGACCACAAACAGAACTCAGATGAACACCCAAGGCTTTGGAGAAACATTTACCGACGTCTATCCAAATGTACCGTCTGCTCCAACCGGGCGCGCTTTTTCACAGAAAGTTTTGGTTCTACTGTACGAGCGGGGACTGAAGCAGCGGTAGGATGTCAAATAATACCACAAATGACAGCTCGTATCCCCACATACGCGTTTGGGCGTCGGGGGTTTCTCTGGTCATCTTGGCTCTTTTCAACCTGGTCATCAACTGGACCATCGTGCGGGAGCAGAGGCTGCGGAGCCACGCGCGCTTCGTCCTCGTTTTTCACCTGCTGTTCTCCGCGCTGGTTTACTTTGCGCTCTGCTTCAGCTTCTACTTACAAAACTA[T/A]CTGAATGCGGCCACCACGGCCACCACATGCACGGTGCTAATAAGAGGACTGATGACCAGCGGTTCCAACATCATCCTCACCATCACGGCGATGGCGCTGGACCGTTATTTCGCCATCTGCTACCCGATGCACTATGGTAAAGTGTTCTTCAAGCCGTGGCCCTGGTTCATCGGGATCCTGACATGGGGACTCGCGTCTGTCATTCCTCTCACTGTGACCCCCAGGAACGCCACGGGAACCTGCGGAAGGAAAGATTTGCAGGGTGGGGAAACACACAAAATCCTTTTGATATCGATTTGCACTGCTCTCATCGTGTGCAGCTATGTGCGGATCTTATATGAGGGGCGACGGCTGGGTGTGTTTAACCGGCGCAACCGAGCTGCGTGTCGGACTATCGCTCTCCACGGAACGCAACTCGCCGTTTACATCCTCCCAAACTTTATACTGTTTTTCCTGCATATTCTCAAGAATAAGGATTTGTTCACATCTGACACCAAAGA
Associated Phenotype:
Not determined