Busch Lab

ZMP

ncoa3

Ensembl ID:
ENSDARG00000077404
ZFIN ID:
ZDB-GENE-051107-8
Description:
SRC3 [Source:UniProtKB/TrEMBL;Acc:Q1L661]
Human Orthologue:
NCOA3
Human Description:
nuclear receptor coactivator 3 [Source:HGNC Symbol;Acc:7670]
Mouse Orthologue:
Ncoa3
Mouse Description:
nuclear receptor coactivator 3 Gene [Source:MGI Symbol;Acc:MGI:1276535]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa21881 Nonsense Available for shipment Available now
sa35062 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10250 Nonsense Available for shipment Available now
sa35063 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21881
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 28 1497 1 22
Genomic Location (Zv9):
Chromosome 11 (position 19085896)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18503210
GRCz11 11 18665552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTTGTGCTCGGACAGGAAGCGCAAACTCTCCACATGTGACACACCAGGA[C/T]AAGGGTGAGACTTTTTTTTTTGTTTGAATGAATGCATTATTGTTGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35062
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Essential Splice Site 116 1497 3 22
Genomic Location (Zv9):
Chromosome 11 (position 19089442)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18506756
GRCz11 11 18669098
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTCAAGGGGTCATCGACAAGGACCATCTGGGCCCTCTGTTGCTGCAG[G/A]TTAGATTAGAGACCTAAGGGTCACCAGAAGAACATTTGCTCATTTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10250
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 311 1497 7 22
Genomic Location (Zv9):
Chromosome 11 (position 19096028)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18513342
GRCz11 11 18675684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTCCTGCATCGCAGYGAGGGTCAGCCCTGGTCATACAAGAGACATTA[T/A]CATGAAGGTATGTGGACAGACACTTGCAGGGATTTTCTTCTCATTTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35063
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Nonsense 844 1497 10 22
Genomic Location (Zv9):
Chromosome 11 (position 19101910)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18519224
GRCz11 11 18681566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTCAAGCCAAAGCTGGAGGAGCTTGAAGCAAGAGGGGCATCTGGAGGG[C/T]AGGGGGCAGGGGTCACGACCTCCAGTTCTAGTAACCAGGAGAGCAAGGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27760
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110621 Essential Splice Site 1495 1497 22 22
Genomic Location (Zv9):
Chromosome 11 (position 19118016)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18535330
GRCz11 11 18697672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACCAAATGTGAACAGATCTTAACTCTTCATTTCTATTTTGTTTTACA[G/A]AAGTACTGCTGAGGCGATGAGCAATCTCCGTCGAAAAAAAAAGGCCGAAC
Associated Phenotype:
Not determined