Busch Lab

ZMP

zgc:195004

Ensembl ID:
ENSDARG00000077399
ZFIN ID:
ZDB-GENE-080724-6
Description:
ubiquitin associated and SH3 domain containing, B-like [Source:RefSeq peptide;Acc:NP_001122227]
Human Orthologue:
UBASH3B
Human Description:
ubiquitin associated and SH3 domain containing B [Source:HGNC Symbol;Acc:29884]
Mouse Orthologue:
Ubash3b
Mouse Description:
ubiquitin associated and SH3 domain containing, B Gene [Source:MGI Symbol;Acc:MGI:1920078]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa12056 Nonsense Available for shipment Available now
sa42534 Nonsense Mutation detected in F1 DNA Not yet available
sa17314 Nonsense Available for shipment Available now
sa42535 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44823 Nonsense Mutation detected in F1 DNA Not yet available
sa42536 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12056
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 79 642 3 14
Genomic Location (Zv9):
Chromosome 15 (position 20266133)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21368759
GRCz11 15 21304491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTCTCATTTGGATGACCCGTTCCTRGATGACTCTTTACCCAGAGAGTA[T/G]GTGCTGTACCTGCGCCCCAGTGGRCCTTTACAAAACCAGCTTTCTCATTT
Long Flanking Sequence:
CCAAAAAATAAAAATAAAATAAATAAATAAATTCCAGATGTTCTTTACTTACTGATCTAATTCTTATATATCAAGGGAGATATTTTGGAAATGCAAGCCAGATGGGATTTAAACTTTGGTAAAGTTTGGTTTTAAAAGAAAAATGTATAATGCTGATTCACTAGTCCTGATTCTAACATTAACCCACAGCATTTGGTTTAGTTTTGTGGCTTTCATTGCAGAATAAAAAATTAGGTAATACTAAAAACCATCTATATACCGTTTCCTAAAAAAGCGATGGATTCATGAAAATGAAAATCTTACTTTTTTATTTACTCCAATTTCCCAAAATGCACTTTAATACAATGTCCAAAAATGGCCTATTCTATTAGTATATTCATAAACTATTCAAGTCAGCTTTTTAAAAAAAGACCCTGATTTATCATAATTTAAATGTGTCTCCATAGGCTTTTCTCTCATTTGGATGACCCGTTCCTAGATGACTCTTTACCCAGAGAGTA[T/G]GTGCTGTACCTGCGCCCCAGTGGACCTTTACAAAACCAGCTTTCTCATTTCTGGCAGCAGTCTCGCTTCACTTGTGGAAAGAACAAAGCTCACAACATATTTCCACACATCACGCTTTGCCAGTTCTTTATGGTGAGTCACACTTTCTATTTGAATCAGATAATCTGTCATGATTATGTTGCAGAATCTTACATGCTCTTACTTTGACGTGTTGTCCAGTGTCCAGACAGTAAACTAGTGGCTCTGTGTGAAGCTCTGCAGTCTTCTGTGAATCAGTGGAGAGGACGTTTCCCCAGCCCTTTGCCTCTGGAGCTCTACACCTCCACCAACTTCATCGGCCTGTTCGTGGAGGAGCAGGTGGCAGAGACGCTTAAGCAGTTTGCCGCGGACTTCGCGGTGGAGGCTGCTGCTAAAGTGGGTGAGGAGGCGTGAGCTGAGCTTTTCCACAGATGGTGCTCATGTTTTGTCTAATCGCCCCATTACTCACTTTGTTCCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42534
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 82 642 3 14
Genomic Location (Zv9):
Chromosome 15 (position 20266142)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21368768
GRCz11 15 21304500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGATGACCCGTTCCTAGATGACTCTTTACCCAGAGAGTATGTGCTGTA[C/A]CTGCGCCCCAGTGGACCTTTACAAAACCAGCTTTCTCATTTCTGGCAGCA
Long Flanking Sequence:
AAAAATAAAATAAATAAATAAATTCCAGATGTTCTTTACTTACTGATCTAATTCTTATATATCAAGGGAGATATTTTGGAAATGCAAGCCAGATGGGATTTAAACTTTGGTAAAGTTTGGTTTTAAAAGAAAAATGTATAATGCTGATTCACTAGTCCTGATTCTAACATTAACCCACAGCATTTGGTTTAGTTTTGTGGCTTTCATTGCAGAATAAAAAATTAGGTAATACTAAAAACCATCTATATACCGTTTCCTAAAAAAGCGATGGATTCATGAAAATGAAAATCTTACTTTTTTATTTACTCCAATTTCCCAAAATGCACTTTAATACAATGTCCAAAAATGGCCTATTCTATTAGTATATTCATAAACTATTCAAGTCAGCTTTTTAAAAAAAGACCCTGATTTATCATAATTTAAATGTGTCTCCATAGGCTTTTCTCTCATTTGGATGACCCGTTCCTAGATGACTCTTTACCCAGAGAGTATGTGCTGTA[C/A]CTGCGCCCCAGTGGACCTTTACAAAACCAGCTTTCTCATTTCTGGCAGCAGTCTCGCTTCACTTGTGGAAAGAACAAAGCTCACAACATATTTCCACACATCACGCTTTGCCAGTTCTTTATGGTGAGTCACACTTTCTATTTGAATCAGATAATCTGTCATGATTATGTTGCAGAATCTTACATGCTCTTACTTTGACGTGTTGTCCAGTGTCCAGACAGTAAACTAGTGGCTCTGTGTGAAGCTCTGCAGTCTTCTGTGAATCAGTGGAGAGGACGTTTCCCCAGCCCTTTGCCTCTGGAGCTCTACACCTCCACCAACTTCATCGGCCTGTTCGTGGAGGAGCAGGTGGCAGAGACGCTTAAGCAGTTTGCCGCGGACTTCGCGGTGGAGGCTGCTGCTAAAGTGGGTGAGGAGGCGTGAGCTGAGCTTTTCCACAGATGGTGCTCATGTTTTGTCTAATCGCCCCATTACTCACTTTGTTCCAAACTGCATGACTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28444
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Essential Splice Site 190 642 4 14
Genomic Location (Zv9):
Chromosome 15 (position 20266553)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21369179
GRCz11 15 21304911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTAAGCAGTTTGCCGCGGACTTCGCGGTGGAGGCTGCTGCTAAAGTGGG[T/G]GAGGAGGCGTGAGCTGAGCTTTTCCACAGATGGTGCTCATGTTTTGTCTA
Long Flanking Sequence:
ATCATAATTTAAATGTGTCTCCATAGGCTTTTCTCTCATTTGGATGACCCGTTCCTAGATGACTCTTTACCCAGAGAGTATGTGCTGTACCTGCGCCCCAGTGGACCTTTACAAAACCAGCTTTCTCATTTCTGGCAGCAGTCTCGCTTCACTTGTGGAAAGAACAAAGCTCACAACATATTTCCACACATCACGCTTTGCCAGTTCTTTATGGTGAGTCACACTTTCTATTTGAATCAGATAATCTGTCATGATTATGTTGCAGAATCTTACATGCTCTTACTTTGACGTGTTGTCCAGTGTCCAGACAGTAAACTAGTGGCTCTGTGTGAAGCTCTGCAGTCTTCTGTGAATCAGTGGAGAGGACGTTTCCCCAGCCCTTTGCCTCTGGAGCTCTACACCTCCACCAACTTCATCGGCCTGTTCGTGGAGGAGCAGGTGGCAGAGACGCTTAAGCAGTTTGCCGCGGACTTCGCGGTGGAGGCTGCTGCTAAAGTGGG[T/G]GAGGAGGCGTGAGCTGAGCTTTTCCACAGATGGTGCTCATGTTTTGTCTAATCGCCCCATTACTCACTTTGTTCCAAACTGCATGACTTTATTTCACATAAATGGGTAAATTTAGCAGAACTGATTTTAGCATACAGTGAAATGTTGCAACACAGGCTCATTGTGTAACCATAACCCTGTATACATTTCTGGAGAGCGTAAATTATGTAGTCAGAGCTACACATGGCTGAATTCCTTTTAAAAAAAAAGAATGCTATAGGGCGGTATGATGCCACAGATGGCTTCTGTTTCCTTTCATGCTACAAGCTGACCGCTTACCTCTATGTGGACAGCTTTACCGATGTTACCACTTTGTCCAGTGGCTCGCTTGTTGATAAGCTTGAGATGCAGAGAGGAGTTGACCGTGACGACGGGGTTTGAGTCCTGTGAACGTTTCCAGAAAGAAGGTAAAACAAAAACAGAAGCCAAAAAATAAAATAAACCATAAATAACAGCGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17314
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 428 642 9 14
Genomic Location (Zv9):
Chromosome 15 (position 20278789)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21381415
GRCz11 15 21317147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAATATGCCTGCAGCTCTGCCTGCTCGGGGTGCAACACATAGGGACTA[C/A]GAAATGGATGCTCCTATAACTGTGRTTGGATCCACACAGGCTAARATAGT
Long Flanking Sequence:
GAGGCGTTTCAAAGATGGCCACCGAGTGAAATAACTTGCCTTAAAAGGACGTTGTTTATAACTACTATTGAACAGTTATTATTTTAATAATAGACAGGGAATAAGCCTGCAGTTAATAGGATGAATTGTGACCTAATCTAGAGTGTTACTCAATAATTAAATGTGTATATATAAAAAAGGTCTGGTATTGTTTTTGTTACTTATAAATTGACATTTTTTGCTGTTGATGGTAGGTCCTTCGCTCTAACATCCAGTCTCGAGCTCCTAAAAGGACCCTGTTTGTATGTCGGCATGGAGAGAGAATGGATGTTGTTTTTGGGAAACACTGGCTCTCTCAGTGTTCTGACTCAAAAGGTAATCTCAACGGATGGGCCATGACTGTGCGCTCATATGGTGCAGTTAGTTTGTGAACTCACTTTGTCTCCTGTAGGCAGGTACGTGAGGAGGAACCTGAATATGCCTGCAGCTCTGCCTGCTCGGGGTGCAACACATAGGGACTA[C/A]GAAATGGATGCTCCTATAACTGTGGTTGGATCCACACAGGCTAAGATAGTGGGTAGGTCTGCTTAGTGTTTTGATGTTAACATGAGTTGACCAGTTGAATTGTCCATCATGCTTGTTTTATGTCATCTGATTTTCAGGGGAGGCTCTGCTGGAAAGTAATACCAGTATTGATTTTGTATATTGTTCACCCAGCCTTCGGTGTGTCCAGACGGCTCATGAAATTCTCAGAGGTATAGTACTGTAGTCAGGAATATGAAGGAAGCAGTGTGCGGGGGAAAGGATTGTTACTATGATATAAATAGGGTTGAATTTTCCTGTTGAGTTATGCTCTATGTTGGCCTGCATTTCAAAGAATTACACTTTAGTTTTTAATGAGCAGATTCAATTTGTTAAAGTTAGTACAGTATTCAAGTGTTTACAGTAGTTTAAGAAAAATAGCAAAACGATTAATTTTTCATAATAGGCTAATTTTATGTACAGAGAAATTTCTACACTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42535
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Essential Splice Site 445 642 9 14
Genomic Location (Zv9):
Chromosome 15 (position 20278842)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21381468
GRCz11 15 21317200
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGGATGCTCCTATAACTGTGGTTGGATCCACACAGGCTAAGATAGTGG[G/A]TAGGTCTGCTTAGTGTTTTGATGTTAACATGAGTTGACCAGTTGAATTGT
Long Flanking Sequence:
GTTTATAACTACTATTGAACAGTTATTATTTTAATAATAGACAGGGAATAAGCCTGCAGTTAATAGGATGAATTGTGACCTAATCTAGAGTGTTACTCAATAATTAAATGTGTATATATAAAAAAGGTCTGGTATTGTTTTTGTTACTTATAAATTGACATTTTTTGCTGTTGATGGTAGGTCCTTCGCTCTAACATCCAGTCTCGAGCTCCTAAAAGGACCCTGTTTGTATGTCGGCATGGAGAGAGAATGGATGTTGTTTTTGGGAAACACTGGCTCTCTCAGTGTTCTGACTCAAAAGGTAATCTCAACGGATGGGCCATGACTGTGCGCTCATATGGTGCAGTTAGTTTGTGAACTCACTTTGTCTCCTGTAGGCAGGTACGTGAGGAGGAACCTGAATATGCCTGCAGCTCTGCCTGCTCGGGGTGCAACACATAGGGACTACGAAATGGATGCTCCTATAACTGTGGTTGGATCCACACAGGCTAAGATAGTGG[G/A]TAGGTCTGCTTAGTGTTTTGATGTTAACATGAGTTGACCAGTTGAATTGTCCATCATGCTTGTTTTATGTCATCTGATTTTCAGGGGAGGCTCTGCTGGAAAGTAATACCAGTATTGATTTTGTATATTGTTCACCCAGCCTTCGGTGTGTCCAGACGGCTCATGAAATTCTCAGAGGTATAGTACTGTAGTCAGGAATATGAAGGAAGCAGTGTGCGGGGGAAAGGATTGTTACTATGATATAAATAGGGTTGAATTTTCCTGTTGAGTTATGCTCTATGTTGGCCTGCATTTCAAAGAATTACACTTTAGTTTTTAATGAGCAGATTCAATTTGTTAAAGTTAGTACAGTATTCAAGTGTTTACAGTAGTTTAAGAAAAATAGCAAAACGATTAATTTTTCATAATAGGCTAATTTTATGTACAGAGAAATTTCTACACTGTAAAGTGTAGGGCAAAAATTCTACTGTTCAACATTTGCTTTTCCACATCCAAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 537 642 12 14
Genomic Location (Zv9):
Chromosome 15 (position 20281502)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21384128
GRCz11 15 21319860
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTGCATTTCCACAGACCTCACATGCCCATCAGCAAACTAACTGTCTCC[G/T]AGGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATT
Long Flanking Sequence:
AAAATAAGTGCAAGCTCCTCAAAATTTGGCACTATTTGTTTATATCTGCATTCAATTCTGTAATTGTAGAATCGCTAAATTCTGGAGGGACTGCACAATACATTTGCTGCTCAGAAGTGCCTTATATGTTAACTTGTATGTTAAAATATATTTCAAATACAGAAAAGGCCATACTTTTGAGCTTTATAATCAAAGAATTCTGAAGAAAAGTCACCCCAGTGTCTTTGCCCCTTTCTCTAGGAATGCAGCAAGAAGGCAGACTAAGCATTCGAGTGGAGCCTGGGCTGTTTGAGTGGACTAAATGGGTGTCAGGAACATCTTTGCCTGCTTGGATACCCCCTACAGATCTTGCTGCAGCCAATCTTAATGTGGACACAACTTACAGGTAAAAACAAAGTTATCATAGACTTTTTTGTGTAGGAGCATATGTCCAGTTCTGTCCTTATTCACAGTTGCATTTCCACAGACCTCACATGCCCATCAGCAAACTAACTGTCTCC[G/T]AGGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATTTTGGCCTACTGCAAAAATAAGGGTAAGTGATTATAAATGCTGCTTCAACTCAAGTGCTTATGATTCTCTCTCACATGTACTAATAGTGGATCTTTTTTTACAACAGGTAAAAATATTCTGTTTGTGGGACATGCTTCCTCTTTGGAGGCCTGCACTCGCCAACTCCAGGGTCTTTCTTCACAGAATTCTAAAGACTTTGTGCAAGTAGTCCGTAAGGTTAGCTTCACCCTTTTTAAACATTTTACAGGCAGATCAATCTCATCAAATACTGCCAGGATATGTGACATCCTATGTAAAAGTACCCAGCTAAAAAAATGTGATTCATTGTTTTGCACATAAAATCATTAAAAGATGGACTTTTCAAAGCTGGTCTTTCCGTCCAGATTCCATACCTGGGTTTGTGTGCCTGTGAGGAGCAAGGGGACTCAGGAATCTGGCAGCTTGTGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42536
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111213 Nonsense 554 642 12 14
Genomic Location (Zv9):
Chromosome 15 (position 20281554)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21384180
GRCz11 15 21319912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATTT[T/A]GGCCTACTGCAAAAATAAGGGTAAGTGATTATAAATGCTGCTTCAACTCA
Long Flanking Sequence:
CAATTCTGTAATTGTAGAATCGCTAAATTCTGGAGGGACTGCACAATACATTTGCTGCTCAGAAGTGCCTTATATGTTAACTTGTATGTTAAAATATATTTCAAATACAGAAAAGGCCATACTTTTGAGCTTTATAATCAAAGAATTCTGAAGAAAAGTCACCCCAGTGTCTTTGCCCCTTTCTCTAGGAATGCAGCAAGAAGGCAGACTAAGCATTCGAGTGGAGCCTGGGCTGTTTGAGTGGACTAAATGGGTGTCAGGAACATCTTTGCCTGCTTGGATACCCCCTACAGATCTTGCTGCAGCCAATCTTAATGTGGACACAACTTACAGGTAAAAACAAAGTTATCATAGACTTTTTTGTGTAGGAGCATATGTCCAGTTCTGTCCTTATTCACAGTTGCATTTCCACAGACCTCACATGCCCATCAGCAAACTAACTGTCTCCGAGGCGTATGAAACATACATTAGTCGCAGCAACCAGGTGACCAAAGACATTT[T/A]GGCCTACTGCAAAAATAAGGGTAAGTGATTATAAATGCTGCTTCAACTCAAGTGCTTATGATTCTCTCTCACATGTACTAATAGTGGATCTTTTTTTACAACAGGTAAAAATATTCTGTTTGTGGGACATGCTTCCTCTTTGGAGGCCTGCACTCGCCAACTCCAGGGTCTTTCTTCACAGAATTCTAAAGACTTTGTGCAAGTAGTCCGTAAGGTTAGCTTCACCCTTTTTAAACATTTTACAGGCAGATCAATCTCATCAAATACTGCCAGGATATGTGACATCCTATGTAAAAGTACCCAGCTAAAAAAATGTGATTCATTGTTTTGCACATAAAATCATTAAAAGATGGACTTTTCAAAGCTGGTCTTTCCGTCCAGATTCCATACCTGGGTTTGTGTGCCTGTGAGGAGCAAGGGGACTCAGGAATCTGGCAGCTTGTGGATCCACCAATTCTTCCCTTGACTCATGGGCCGAACCACAGCTTCAGCTGGAGAGA
Associated Phenotype:
Not determined