Busch Lab

ZMP

si:dkey-6h5.1

Ensembl ID:
ENSDARG00000077384
ZFIN ID:
ZDB-GENE-100922-8
Human Orthologue:
DNAH11
Human Description:
dynein, axonemal, heavy chain 11 [Source:HGNC Symbol;Acc:2942]
Mouse Orthologue:
Dnahc11
Mouse Description:
dynein, axonemal, heavy chain 11 Gene [Source:MGI Symbol;Acc:MGI:1100864]

Alleles

There are 16 alleles of this gene:

Allele Name Consequence Status Availability
sa44849 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22809 Nonsense Available for shipment Available now
sa36096 Nonsense Mutation detected in F1 DNA Not yet available
sa42701 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11778 Nonsense Available for shipment Available now
sa42700 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42699 Nonsense Mutation detected in F1 DNA Not yet available
sa22808 Nonsense Available for shipment Available now
sa39096 Nonsense Mutation detected in F1 DNA Not yet available
sa39095 Missense Mutation detected in F1 DNA Not yet available
sa18093 Nonsense Available for shipment Available now
sa22807 Essential Splice Site Available for shipment Available now
sa42698 Nonsense Mutation detected in F1 DNA Not yet available
sa6421 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22806 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44849
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 414 4362 7 83
ENSDART00000148294 Essential Splice Site 349 1936 6 35
Genomic Location (Zv9):
Chromosome 16 (position 21318270)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19555145
GRCz11 16 19360964
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTATGCCTGGCCTTTCAAGATTGTTCAGGATTGGAATCAGTTTTCAAA[G/A]TAAGCATTTCTGATAGATTTAGTTAGAATTGTTAAGAAAAAAAGAGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22809
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 423 4362 8 83
ENSDART00000148294 Nonsense 358 1936 7 35
Genomic Location (Zv9):
Chromosome 16 (position 21318145)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19555020
GRCz11 16 19360839
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTCAATCTGAATTTGTTTAAAGCTGGTCACCGTGTTCAAACCCCTCT[T/A]GGACAGAGACATCATAAAGGAATCTTTTATTCCCAAGTTCTTTGAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 531 4362 10 83
ENSDART00000148294 Nonsense 466 1936 9 35
Genomic Location (Zv9):
Chromosome 16 (position 21317607)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19554482
GRCz11 16 19360301
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTACCAGGAGATGTCCTCTCTTTTGGATGAGTATGAGAAGCAGGTCTA[T/G]TTGAGATGGTGTGGTGATATTAACCATGTCTGCCAGATGAACCTCGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42701
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 1100 4362 17 83
ENSDART00000148294 Essential Splice Site 1035 1936 16 35
Genomic Location (Zv9):
Chromosome 16 (position 21310527)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19547402
GRCz11 16 19353221
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATAATGCGGAGGTGGTTATCATCCGCAGGAAGTGTGTAGCCTTTGAG[G/A]TGAGATACTTATTAAACAATGTCTATATTATTTGAAAGGGTGAAACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11778
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 1553 4362 29 83
ENSDART00000148294 Nonsense 1485 1936 27 35
Genomic Location (Zv9):
Chromosome 16 (position 21280088)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19516963
GRCz11 16 19322782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGCTAAAGGTGTGAGTTGTTTCTTCTCAGGTTGAGCTCTGGCTGAACTG[T/A]CTGGAGGATGTGATGAAAGAGGGAGTGAGAAGATTCATAGCTGAGGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 1624 4362 29 83
ENSDART00000148294 Essential Splice Site 1556 1936 27 35
Genomic Location (Zv9):
Chromosome 16 (position 21279873)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19516748
GRCz11 16 19322567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTGAGGGTTTTGAGACGGCACTCAGAGACTACAACAAGAAACAGG[T/G]CAGTCACATACATTATACAAACTGCACAATATTGCTATTATAACTGTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4652
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 1774 4362 32 83
ENSDART00000148294 Essential Splice Site 1706 1936 30 35
Genomic Location (Zv9):
Chromosome 16 (position 21271173)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19508048
GRCz11 16 19313867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCATCATGGTGTACGTCTTCAACTGCTCTGAACAGATGGACTATAAGG[T/A]AGGCATACTAGCAGAGATGGGACTCGGCAACCTCAGGACATTTACCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42699
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 1809 4362 33 83
ENSDART00000148294 Nonsense 1741 1936 31 35
Genomic Location (Zv9):
Chromosome 16 (position 21266571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19503446
GRCz11 16 19309265
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGAGTTTAACCGGATCGCTGTGGAAGTGCTGTCAGTGGTGGCAGTG[C/T]AAGTAAAGACCATACATGATGCCATTCGCAACCAGAGCAAAAGGTAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22808
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 2030 4362 39 83
ENSDART00000148294 None None 1936 None 35
Genomic Location (Zv9):
Chromosome 16 (position 21257458)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19494423
GRCz11 16 19300152
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTAATGATCGTGAATAATCCTAAAGAGTATCCCTGCTTTGTCCCAAAA[C/T]AGATCCTAAAAACTCTTCACAAAACTTACTTCAACATGGGAAGGAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 2298 4362 44 83
ENSDART00000148294 None None 1936 None 35
Genomic Location (Zv9):
Chromosome 16 (position 21251637)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19488602
GRCz11 16 19294331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTCCTGTCCAGGGCTCTGTGTTTGACTTCTGCTTAGATCCTCACTCC[A/T]AACGCTTTGTGCCCTGGACCGACAGGATACCTGCTTTTGAGATGGACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39095
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Missense 2821 4362 53 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21211802)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19448557
GRCz11 16 19254196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAAAACTGCTGGAGGTTCTTTATGAATCGAGTGCGACATCAGCTCAAGG[T/A]CTTTCTGCAGTTTTTTTTTTTTTTTTTTGTATGCACAGCAGTTATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 3285 4362 62 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21178016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19414771
GRCz11 16 19220410
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGCCATATCGCCAKCAGCTCCTTCAYGACAWGCTGATTCCTTTYCTC[A/T]GAGAACTCCGGGTATGATTTCYGCTTCACATTATTCTCAGTTGTCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22807
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 3578 4362 None 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21167833)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19404588
GRCz11 16 19210227
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTAAAGAACTTCACAATGTTAATCCCATGTACCAGTACTCCCTCAAGG[T/C]AACACACTACACATCTGCCTTATTTACAGTAGTTCAGATAAATAGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42698
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 3966 4362 74 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21160409)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19397164
GRCz11 16 19202803
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATACCCATTCAACAATGGAGATCTGAATATTTCAGCTAATGTTCTGTA[C/A]AACTACCTGGAGGCCAGTACCAAAGTAAGATATCACTATTCATTACCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6421
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Essential Splice Site 4196 4362 None 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143431)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380186
GRCz11 16 19185825
KASP Assay ID:
554-4894.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGTTGGAGCAGGCTGACCTTTCCTTCAACTAAAACCCTGCCTCARTGG[T/A]ATAATCACCTACATAGATCTTTCTGATACAGACAAACACTAAACCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22806
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020821 Nonsense 4210 4362 81 83
ENSDART00000148294 None None 1936 None 35

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 21143306)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19380061
GRCz11 16 19185700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGTTTAGTGATGTTCTGGCTCAGTGTCGAGAGCTGGACACATG[G/A]ACTCACGACTTTGTGTTTCCCGCCGTGGTTTGGATCTCTGGACTTTTTAG
Associated Phenotype:
Not determined