Busch Lab

ZMP

si:ch211-195h3.2

Ensembl ID:
ENSDARG00000077367
ZFIN ID:
ZDB-GENE-081105-186
Description:
Novel protein similar to vertebrate netrin G2 (NTNG2) [Source:UniProtKB/TrEMBL;Acc:B0UX66]
Human Orthologue:
NTNG2
Human Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Mouse Orthologue:
Ntng2
Mouse Description:
netrin G2 Gene [Source:MGI Symbol;Acc:MGI:2159341]

Alleles

There are 9 alleles of this gene:

Allele Name Consequence Status Availability
sa34335 Nonsense Mutation detected in F1 DNA Not yet available
sa21214 Nonsense Available for shipment Available now
sa18661 Nonsense Available for shipment Available now
sa18579 Nonsense Available for shipment Available now
sa34336 Nonsense Mutation detected in F1 DNA Not yet available
sa34337 Nonsense Mutation detected in F1 DNA Not yet available
sa18909 Nonsense Mutation detected in F1 DNA Not yet available
sa10911 Nonsense Available for shipment Available now
sa34338 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34335
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 61 1256 1 13
ENSDART00000132492 Nonsense 53 343 1 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12510839)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11955602
GRCz11 8 11993307
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTACGCTTGCCAGCCCAAACCCATGTCCATGAAGGAGTACATGCAGATT[A/T]GAGTGGAGCCTCCCGATATCACATGTGGAAACCCACCGGAGAGATACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21214
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 108 1256 2 13
ENSDART00000132492 Nonsense 100 343 2 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12533702)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11978465
GRCz11 8 12016170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTCCACCAAAGAACTGGCTCATCCTCCAGAGCTGATGCAAGACAGCGAG[C/T]GAACCGGACTCATCACCTACTGGCAGACGGTAACATGGAGTCGATATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 135 1256 2 13
ENSDART00000132492 Nonsense 127 343 2 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12533785)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11978548
GRCz11 8 12016253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGGAGTCGATATCCTGMGCCTCTTCTGGCCAACATATCCTTATCCTG[G/A]AACAAAAGCCTTGAGTTAACAGATGACATCCAGATATCCTTTGAGTATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18579
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 505 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608186)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12052949
GRCz11 8 12090654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
MAGCAACTGACACCGTCTTTGCAACAACTGCCTTYGGTGCAAGCAATCCA[C/T]GATCTGCTCTTCCTGAGGTTACTGATGCACTTGCTTCATCATCTGATGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34336
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 531 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608264)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12053027
GRCz11 8 12090732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTGCTTCATCATCTGATGCCACTGCAACAACACTTAATATGGTCATC[C/T]GAGCAACCATGGCAACAACACCTTCTGTAACCATGGCAACTTCTGAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34337
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 695 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12608757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12053520
GRCz11 8 12091225
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGAAGTCGTCATGAGAAGTGAAGAAACAGTCAGCACTGACGTAGACT[C/A]GCCTACATCGGGTGTAACTCTTCTGACAGGTGAGCCAGTGCCTGATGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18909
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12609653)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12054416
GRCz11 8 12092121
KASP Assay ID:
2260-0236.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCCTGATCGTAAACCTTTATCCAAAGTAGGAGAAAACAGCGAAGAGTCC[A/T]AGGAATCGAAAACAGCTTTAAATTCGGAGAAGAAAGATAAAGATGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10911
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
ENSDART00000114432 Nonsense 994 1256 8 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12609653)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12054416
GRCz11 8 12092121
KASP Assay ID:
2260-0236.1 (used for ordering genotyping assays)
KASP Sequence:
CCCCTGATCGTAAACCTTYATCCAAAGTAGGRGAAAACAGCGAAGAGTCC[A/T]ARGAATCGAAAACAGCTTTAAATTCGGAGAARAAAGATAAAGATGCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34338
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114432 Nonsense 1048 1256 9 13
ENSDART00000132492 None None 343 None 3
ENSDART00000138101 None None 156 None 3
Genomic Location (Zv9):
Chromosome 8 (position 12611361)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12056124
GRCz11 8 12093829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAAAAGAGCAAAGAAGCCAAGGAGGAAAAGAAAGAGAAAGAAAAGCAC[A/T]AAGAAAAGGAGTTTAAAGAGTATGAGAAAAAAGGTATACACATAGTGGAC
Associated Phenotype:
Not determined