Busch Lab

ZMP

si:ch211-247j9.2

Ensembl ID:
ENSDARG00000077364
ZFIN ID:
ZDB-GENE-091117-28
Human Orthologue:
MAPK9
Human Description:
mitogen-activated protein kinase 9 [Source:HGNC Symbol;Acc:6886]
Mouse Orthologue:
Mapk9
Mouse Description:
mitogen-activated protein kinase 9 Gene [Source:MGI Symbol;Acc:MGI:1346862]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23984 Nonsense Available for shipment Available now
sa37352 Nonsense Available for shipment Available now
sa18329 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23984
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 172 421 6 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31122287)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32321757
GRCz11 21 32355015
KASP Assay ID:
2261-5832.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGGTGAAGTCCGACTGCACTTTAAAGATCTTAGACTTTGGACTGGCC[A/T]GAACCGCCTGCACTAATTTTATGATGACACCTTATGTAGTGACCAGATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29630
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Essential Splice Site 228 421 None 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31122020)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32321490
GRCz11 21 32354748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATGGGCGAAATGGTTAAAGGGAGCGTCATATTCCAGGGCACTGATCG[T/A]ATCCACTTAATTCTAAAACCTGAAAAATAAGCAGTTAAGCTTGCATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37352
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 322 421 9 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31119926)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32319396
GRCz11 21 32352654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCGTATCTCTGTGCAGGAGGCTCTTAATCACCCCTACATTCATGTGTG[G/A]TACGACCCAGCTGAGGCTGATGCGGTCAGTGCACCTCTGTCTATCTATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4956
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Essential Splice Site 331 421 10 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31119771)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32319241
GRCz11 21 32352499
KASP Assay ID:
554-3599.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCAGGGAGGTCTTGGGCCTTGAATTTGTACTGATTGTTTTATGTGTTC[A/T]GCCTCCTCCACAGATCTCAGACAAGCAGCTTGAGGAGCGSGAACACAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18329
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112550 Nonsense 334 421 10 12

The following transcripts of ENSDARG00000077364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 31119760)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32319230
GRCz11 21 32352488
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTGGGCCTTGAATTTGTACTGATTRTTTTATGTGTTCWGCCTCCTCCA[C/T]AGATCTCAGACAAGCAGCTTGAGGAGCGSGAACACAGCAYYGAGCAGTGG
Associated Phenotype:
Not determined