Busch Lab

ZMP

BPTF

Ensembl ID:
ENSDARG00000077361
Description:
bromodomain PHD finger transcription factor [Source:HGNC Symbol;Acc:3581]
Human Orthologues:
AC005829.1, AC103810.3, BPTF
Human Description:
bromodomain PHD finger transcription factor [Source:HGNC Symbol;Acc:3581]
Mouse Orthologue:
Bptf
Mouse Description:
bromodomain PHD finger transcription factor Gene [Source:MGI Symbol;Acc:MGI:2444008]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa33174 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38389 Nonsense Mutation detected in F1 DNA Not yet available
sa13237 Essential Splice Site Available for shipment Available now
sa7544 Missense Mutation detected in F1 DNA Not yet available
sa12837 Nonsense Available for shipment Available now
sa20012 Nonsense Available for shipment Available now
sa20011 Nonsense Available for shipment Available now
sa20010 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33174
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Essential Splice Site 161 2725 1 36
Genomic Location (Zv9):
Chromosome 3 (position 25521716)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25289901
GRCz11 3 25420449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGACGATGCGAGTTACTGCACGGAGAGCAGCCACGGCAGCAACACAGG[T/A]ACGGACGCTTCGTCGGACCCACGAATTGCTGATAAGTGCGCTGCGATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38389
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 577 2725 5 36
Genomic Location (Zv9):
Chromosome 3 (position 25513311)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25281496
GRCz11 3 25412044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAGCTCGAACGATTCATGTCCACAACAAGACTCTAGTAATGGGAATGCA[C/T]GAAATGAGCAAACGTCTTCAGACGGTGAGAGATGTGTTTGCTCGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Essential Splice Site 942 2725 14 36
Genomic Location (Zv9):
Chromosome 3 (position 25506754)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25274939
GRCz11 3 25405487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGCAGCAGGCCACATGGGTGAAGTACACTTTCCCCATCAAACACCAGG[T/C]ACGTTAGAGCACTTGCAAGCTATGTGTTTCTGTTAAAAAAATAMCATCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7544
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Missense 1093 2725 17 36
Genomic Location (Zv9):
Chromosome 3 (position 25505836)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25274021
GRCz11 3 25404569
KASP Assay ID:
554-4058.1 (used for ordering genotyping assays)
KASP Sequence:
ARCAATGCTTTTGGCATGATGTTGTAAAYGTTAGTGAAGGCTTTTTACAA[C/G]GCACAGCATACAAGAAATTAAAGCCATCAAAACTTGATGGCCTTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 1348 2725 17 36
Genomic Location (Zv9):
Chromosome 3 (position 25505069)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25273254
GRCz11 3 25403802
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAGGAACCAGTAAAGTCACTAATGAATGGTGACGCCASTCAAGAGTG[T/A]CTTAAAGAATGGACTAATAGCACGATTCCTCAGGTGAATTTGGATGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20012
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 1573 2725 17 36
Genomic Location (Zv9):
Chromosome 3 (position 25504396)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25272581
GRCz11 3 25403129
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTAAAATCTATGACTGTAAGTCATGAATATTCCACCAGGGACAGAGTA[C/T]GACTATTAAAGTTTTCTCGCACCAAGAAAACGAGGTCGGGAACAGCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Nonsense 2003 2725 25 36
Genomic Location (Zv9):
Chromosome 3 (position 25499225)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25267410
GRCz11 3 25397958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTCCCCACACCAAACCAACCCCAGACCCCACAGACGCCCGCTTCTCCA[C/T]GACCACAGCAGGGTCAGGTCAAACTCACTCTGGCCCAGCTCACACAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109601 Essential Splice Site 2478 2725 30 36
Genomic Location (Zv9):
Chromosome 3 (position 25491976)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 25260161
GRCz11 3 25390709
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGAAGAAAAGAGCTCTGCTGGATAAGGAACTGCAGCTGCAAGTGCAG[G/A]TAAGCAACAGCAAAAGACCAAACTTTCTCTGATTTACACTGATCTGAGAT
Associated Phenotype:
Not determined