Busch Lab

ZMP

si:dkey-21o19.6

Ensembl ID:
ENSDARG00000077327
ZFIN ID:
ZDB-GENE-090313-245
Human Orthologue:
ANO7
Human Description:
anoctamin 7 [Source:HGNC Symbol;Acc:31677]
Mouse Orthologue:
Ano7
Mouse Description:
anoctamin 7 Gene [Source:MGI Symbol;Acc:MGI:3052714]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24326 Nonsense Available for shipment Available now
sa45801 Nonsense Mutation detected in F1 DNA Not yet available
sa18464 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa766
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Nonsense 156 893 4 23
ENSDART00000139514 None None 648 None 17
ENSDART00000145489 Nonsense 156 199 4 5
Genomic Location (Zv9):
Chromosome 23 (position 24479506)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24266072
GRCz11 23 24192623
KASP Assay ID:
554-0672.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCTACATCTTCAGGAGGAATCCTCCAGTGTAAAGAAGACTATCCACTA[T/A]CTGAAGCTTCATGCTCCGTGGGACGTGCTGGTGTACTATGCTGAGGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24326
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Nonsense 420 893 11 23
ENSDART00000139514 Nonsense 175 648 5 17
ENSDART00000145489 None None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24470358)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24256924
GRCz11 23 24183475
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTTGATCATCCCGGGACGGTCTTCTTCAGTGTGTTCATGTCTTTGTG[G/A]GCTGTCACGTTCTTGGAGTACTGGAAACGTAAGAATGCCACTCTCGCTCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4347
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Essential Splice Site 527 893 13 23
ENSDART00000139514 Essential Splice Site 282 648 7 17
ENSDART00000145489 None None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24468556)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24255122
GRCz11 23 24181673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTAAGCGTAATGATGTTCGAAACTGGCAGTTCTGTTCTRCGTACTCAGG[T/C]GGGCACCAAATCCATCTGCATTAAATATAAAGCCTGTAATGCAGCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45801
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Nonsense 592 893 15 23
ENSDART00000139514 Nonsense 347 648 9 17
ENSDART00000145489 None None 198 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24467965)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24254531
GRCz11 23 24181082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCAAAGTCTTCATCTTTCAGTTTGTCAACTTTTACTCATCACCTTTCTA[T/A]GTGGCCTTCTTCAAGGGCAGGTAATCTGTTAACCAGCCTAGCAAAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18464
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Essential Splice Site 695 893 18 23
ENSDART00000139514 Essential Splice Site 450 648 12 17
ENSDART00000145489 None None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24465571)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24252137
GRCz11 23 24178688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATGAGTTGATTCCCTGYGAGGGACTTTTTGACGAATATYTGGAGATTG[G/A]TAAGATGATAGTCTTTCCGCTTTTGTAAGCTTTTCATTTCTGTCAGAAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29924
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112370 Essential Splice Site 765 893 20 23
ENSDART00000139514 Essential Splice Site 520 648 14 17
ENSDART00000145489 None None 199 None 5
Genomic Location (Zv9):
Chromosome 23 (position 24461681)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24248247
GRCz11 23 24174798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTGTTATCCAATATATATATATATATATATATATATTTTCCCTCTAC[A/G]GGCATTCCTCATTGCGTTCACCTCAGATTTTCTGCCCCGTCTTCTGTACC
Associated Phenotype:
Not determined