Busch Lab

ZMP

LOC565513

Ensembl ID:
ENSDARG00000077317
Human Orthologue:
SNX29
Human Description:
sorting nexin 29 [Source:HGNC Symbol;Acc:30542]
Mouse Orthologue:
Snx29
Mouse Description:
sorting nexin 29 Gene [Source:MGI Symbol;Acc:MGI:1921728]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa12737 Nonsense Available for shipment Available now
sa15604 Nonsense Available for shipment Available now
sa38885 Nonsense Mutation detected in F1 DNA Not yet available
sa35267 Essential Splice Site Available for shipment Available now
sa22080 Nonsense Available for shipment Available now
sa35268 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12737
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location (Zv9):
Chromosome 12 (position 20509204)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19291048
GRCz11 12 19412922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACCGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 80 823 4 21
Genomic Location (Zv9):
Chromosome 12 (position 20509204)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19291048
GRCz11 12 19412922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTAGCCCTCACAGCAGCTGCCATTAAACATGTTGCAGGATTTAGCAGT[A/T]AAACYGAAGCAGGYAMTGTAACTGGCTCCAGCAAMWAATGCACATCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38885
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 492 823 12 21
Genomic Location (Zv9):
Chromosome 12 (position 20540418)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19322262
GRCz11 12 19444136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTGCGGCAAGCCATTGTGGCCATGATGAACCGAAAAGATGAACTCACT[G/T]AGCAGAACACGTAGGAATTTCTAAATTACCTTTACTGATGGCATACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35267
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Essential Splice Site 538 823 13 21
Genomic Location (Zv9):
Chromosome 12 (position 20543364)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19325208
GRCz11 12 19447082
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCGAGCTTGAGGAGAGACATGCTGCCAAAGTCCAAGCTCTCATGAGG[T/C]AATATCGCAATAGACTGACTGAAAAGTATTCTTACATAGACAAACTAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22080
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 550 823 14 21
Genomic Location (Zv9):
Chromosome 12 (position 20557054)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19338898
GRCz11 12 19460772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACATTTTTGCAGAGAGAATGAAGTTCTGAAGGTTCAGCTAAAGAAGTA[T/A]GTTGGGGCTGTCCAAATGCTGAAAAGGGAAGGCAGCCAAGGCGGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35268
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Essential Splice Site 567 823 15 21
Genomic Location (Zv9):
Chromosome 12 (position 20611417)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19393261
GRCz11 12 19515135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTTATGGAAAATATAAATGCTTTGTCTAATGTGTTACATTCTATTTCC[A/T]GCATTAACCAATCAGAGGAATTGTGAAGGTCTGCCTCCTGCCCCCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9437
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114248 Nonsense 571 823 15 21
Genomic Location (Zv9):
Chromosome 12 (position 20611430)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 19393274
GRCz11 12 19515148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATAAATGCTTTGTCTAATGTGTTAYATTCTATTTCCAGCATTAACCAAT[C/T]ARAGGAATTGTGAAGGTCTGCCTCCTGCCCCCCAAAGCCGGTCTATGGCT
Associated Phenotype:
Not determined