Busch Lab

ZMP

B0V213_DANRE

Ensembl ID:
ENSDARG00000077310
Description:
Novel protein with a Pentaxin family domain [Source:UniProtKB/TrEMBL;Acc:B0V213]
Human Orthologue:
GPR144
Human Description:
G protein-coupled receptor 144 [Source:HGNC Symbol;Acc:18651]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13107 Nonsense Available for shipment Available now
sa34518 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3679
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Nonsense 200 1066 4 25
ENSDART00000131450 Nonsense 225 614 5 10
Genomic Location (Zv9):
Chromosome 8 (position 54897414)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52807930
GRCz11 8 52794223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GYCGCGGTCAAACCGACAGAAAGGTCCGCCTGGCGCTCCTCATTCAAGGG[C/T]AACATCATCCATACAAAGCCGAGCTGTCGGTCGAYGGAAACTGGCACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13107
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Nonsense 401 1066 6 25
ENSDART00000131450 Nonsense 426 614 7 10
Genomic Location (Zv9):
Chromosome 8 (position 54892827)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52812517
GRCz11 8 52798810
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAGAGAGTCTCTGAGGTCCAACCCCAGTCCCTTCATGCARAGTCTCATG[C/T]WGTACGGCATGGTAGGAGCTTTTTACCRTTAATATRGCACACACAATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34518
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109328 Essential Splice Site 872 1066 17 25
ENSDART00000131450 None None 614 None 10

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 54876303)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52829041
GRCz11 8 52815334
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGTGTCATTTGGGCTTTTGCAGGGCCGGTGCTCTTTGTTTTGGCT[G/A]TAAGTATGTCTTTTATCTTATTTCAGCTAATAGGATTGTAGAATACTGAT
Associated Phenotype:
Not determined