Busch Lab

ZMP

usp42

Ensembl ID:
ENSDARG00000077300
ZFIN ID:
ZDB-GENE-030131-5739
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:Q802X0]
Human Orthologue:
USP42
Human Description:
ubiquitin specific peptidase 42 [Source:HGNC Symbol;Acc:20068]
Mouse Orthologue:
Usp42
Mouse Description:
ubiquitin specific peptidase 42 Gene [Source:MGI Symbol;Acc:MGI:1924050]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42004 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35250 Nonsense Mutation detected in F1 DNA Not yet available
sa10774 Essential Splice Site Available for shipment Available now
sa35249 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3820
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 47 1047 2 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18656411)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17466988
GRCz11 12 17588862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGACATGGAGAGCAGTAGTTCGAGCTGGAGTGTTGGCCCTTCTGCCACT[G/T]AGCTTTCAAGGGCCAAGACGGTCTGTATGGCCCCGGCCATTGGWGCGACT
Long Flanking Sequence:
AAACTATTGTGCTTAGAAAAAACAATACAAAAAGAAAAATAGCACAGTATCGGGATCAGATCTGTAACGATCGAAACTCAGAATTTTGGTATCGAGATCGCATCGGTTCTAAAAAATGGTATTGTGCATCCTCACTTTAGAAGAGCAAAGTAAGTTTTTATTTATTTTTTATTTATATGAACTCATTTAATTTAATAACGAGTTTGGCTTTCCTCTTGCGTACTAGTCACATTTGACACAAAGACTAGTTGTGTTTGAATCACTGCCTTTAAAACTATTTTACAAATTAATCTGTCTGTATTGTCAAAAAGGATTGAGGTTAGAGGTAACATGCATGTTTGTTTTTCCACAGAAAATGAATAATGACCATAGTTGACAAACCTCCAGAGAAACCTGACCTGGAGTCAGTGCGGTGCAAGCACTCCAGCTCCATCACACCATTCTCCTCCAGAGACATGGAGAGCAGTAGTTCGAGCTGGAGTGTTGGCCCTTCTGCCACT[G/T]AGCTTTCAAGGGCCAAGACGGTCTGTATGGCCCCGGCCATTGGAGCGACTGTGAATGGTAGTAATAACACAGCACTCCAAGTCGAAAGGCCACGAGAGCAAGGCAAGTACTTTTTATTTATTTTTTTGTGTTGGGTGATCTTTGGTGGAGGGGAAATTGGAAAAAAATCAAGATTTACAGAATGACTTGAATTTTGAATGATGAGGGTGATTTTTGTTAAAGAGATTGAAAGGAAAAAATCTGCCATCATTTGCTCAACCTTGTTAAAAACCTGCTTGAGTATTTTGGGGGTTCTGTTGAACACAAAAGAAGATACATTGAAGAATCTAAAACCTGTAACCTTGAATATTTAATGTTTATTTGGCAGTGAACTACTCCGATGGATAGATTTCAATAACTGTTTGTTTACACTCATGAAAAATGATCACTGCTGTTATGAATTTTTAAAACCTTCATAAAATTATACCCTTTTTCTCAAACACTGTTGGAACAGAATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42004
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 244 1047 6 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18653542)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17464119
GRCz11 12 17585993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAACCACTTTTGTACATCAGATTTTTGGAGGATATCTGAGATCCAGAGG[T/C]AGGTCACTCATTTCGTTTGACTCGGATTTAATGTATTTGTATTTGAATGT
Long Flanking Sequence:
CACACAAACTGGTACAATTCCAAATATGGCTTTTTCATGGCTCTTGGAGACAGCCCCAAGATAAGGGTTGAGAGTTAAGCAAATAAATATTGAGGTTAAACCATGATGTTAATATAAAAACAAGAACAGTGATAAGGAATGGCATGGGATGACAGCTATTTTTAAAACATGGTCCACTGATATTTTGTTCTTCTCCTCAGGGATTGGAAAGCATTTTAGATTTGGAAGTCAAGAAGATGCCCACGAGTTCTTGAGGTACACTGTGGATGCTATGCAAAAGTCCTGCCTTCCTGGAAACAAGTGAGTTCACATAATGCTGTTTTGTTTGCCAGTTTACAAGCAGTGTAAGGCATGAAACTTAACATTTCCACATTTGTCGATGCAATGACTTCGTTATTACCTCCATTTTAACACTACTTTTATCTTGTCAGACTGGACAGGCAAACTCAGGCAACCACTTTTGTACATCAGATTTTTGGAGGATATCTGAGATCCAGAGG[T/C]AGGTCACTCATTTCGTTTGACTCGGATTTAATGTATTTGTATTTGAATGTAATAATTAGTTTGCTCTAGATTTCTTGTATTTGTTGGCATCAGTTGTTAATGAACATTTCTTTTTCACAGTCAAATGTCTGAATTGCAAAGCAGTCTCTGATACTTTCGATCCATATTTGGATATTTCATTGGAGATAAAGGTGAAAGATTTTTTCTCTCTTAACATCAATTCTTGCAGTTTATGCACAAGTTTTAAAGATTGAAATGGTGACTTTGTGTGCTTCTTCGCAGACGGCTCAGACACTCTCTAAGGCGTTTGAGCAATTTGTAAAACCTGAGCAACTTGATGGGGACAATGCCTATAAATGCTCCAAGTAAGTCTTCTGTTCATATGAATACCACATCATTGTATTATTCAAGAATTTAATTTGTGCAATGGTATTGCATTTATACTTTCACTTTCATTCAAGCTGACAGTAATCTTTTTTTTGTCTTGTCAGATGTAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27931
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 268 1047 8 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18653261)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17463838
GRCz11 12 17585712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATGCACAAGTTTTAAAGATTGAAATGGTGACTTTGTGTGCTTCTTCGC[A/C]GACGGCTCAGACACTCTCTAAGGCGTTTGAGCAATTTGTAAAACCTGAGC
Long Flanking Sequence:
CCTGCCTTCCTGGAAACAAGTGAGTTCACATAATGCTGTTTTGTTTGCCAGTTTACAAGCAGTGTAAGGCATGAAACTTAACATTTCCACATTTGTCGATGCAATGACTTCGTTATTACCTCCATTTTAACACTACTTTTATCTTGTCAGACTGGACAGGCAAACTCAGGCAACCACTTTTGTACATCAGATTTTTGGAGGATATCTGAGATCCAGAGGTAGGTCACTCATTTCGTTTGACTCGGATTTAATGTATTTGTATTTGAATGTAATAATTAGTTTGCTCTAGATTTCTTGTATTTGTTGGCATCAGTTGTTAATGAACATTTCTTTTTCACAGTCAAATGTCTGAATTGCAAAGCAGTCTCTGATACTTTCGATCCATATTTGGATATTTCATTGGAGATAAAGGTGAAAGATTTTTTCTCTCTTAACATCAATTCTTGCAGTTTATGCACAAGTTTTAAAGATTGAAATGGTGACTTTGTGTGCTTCTTCGC[A/C]GACGGCTCAGACACTCTCTAAGGCGTTTGAGCAATTTGTAAAACCTGAGCAACTTGATGGGGACAATGCCTATAAATGCTCCAAGTAAGTCTTCTGTTCATATGAATACCACATCATTGTATTATTCAAGAATTTAATTTGTGCAATGGTATTGCATTTATACTTTCACTTTCATTCAAGCTGACAGTAATCTTTTTTTTGTCTTGTCAGATGTAAGAAAATGGTTACTGCCTCAAAGAGATTCACCGTTCATCGCAGTTCTAATGTTCTCACAATCTCACTAAAGCGGTTTACCAACTTTAATGGAGGAAAAATAACAAAGGTGAAGCAGATAATTGTGTTACTGCTTGCTAAGTTCCTGTTGTGACCAGACCCATCACCTGTATTATTGTCTCCTTTATACATGACCTTTTACATATAGTTTTAAATGGATTTATTGTCTTTTAGAAACATTAAAATCTTATCAGTAAATACATTTGTTATTCCATTATCACTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35250
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 296 1047 9 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18653047)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17463624
GRCz11 12 17585498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCACTTTCATTCAAGCTGACAGTAATCTTTTTTTTGTCTTGTCAGATG[T/A]AAGAAAATGGTTACTGCCTCAAAGAGATTCACCGTTCATCGCAGTTCTAA
Long Flanking Sequence:
AGAGGTAGGTCACTCATTTCGTTTGACTCGGATTTAATGTATTTGTATTTGAATGTAATAATTAGTTTGCTCTAGATTTCTTGTATTTGTTGGCATCAGTTGTTAATGAACATTTCTTTTTCACAGTCAAATGTCTGAATTGCAAAGCAGTCTCTGATACTTTCGATCCATATTTGGATATTTCATTGGAGATAAAGGTGAAAGATTTTTTCTCTCTTAACATCAATTCTTGCAGTTTATGCACAAGTTTTAAAGATTGAAATGGTGACTTTGTGTGCTTCTTCGCAGACGGCTCAGACACTCTCTAAGGCGTTTGAGCAATTTGTAAAACCTGAGCAACTTGATGGGGACAATGCCTATAAATGCTCCAAGTAAGTCTTCTGTTCATATGAATACCACATCATTGTATTATTCAAGAATTTAATTTGTGCAATGGTATTGCATTTATACTTTCACTTTCATTCAAGCTGACAGTAATCTTTTTTTTGTCTTGTCAGATG[T/A]AAGAAAATGGTTACTGCCTCAAAGAGATTCACCGTTCATCGCAGTTCTAATGTTCTCACAATCTCACTAAAGCGGTTTACCAACTTTAATGGAGGAAAAATAACAAAGGTGAAGCAGATAATTGTGTTACTGCTTGCTAAGTTCCTGTTGTGACCAGACCCATCACCTGTATTATTGTCTCCTTTATACATGACCTTTTACATATAGTTTTAAATGGATTTATTGTCTTTTAGAAACATTAAAATCTTATCAGTAAATACATTTGTTATTCCATTATCACTTCACAGGATGTGAGGTACGCAGAGCATCTAGATCTGCGTCCATTCATGTCTCAGTCTCATGGGGAGCCACAAATCTATGCTCTGTATGCTGTGTTGGTTCATTCTGGGTTCAGTTGCCACGCTGGACATTACTACTGCTACATTAAGGTATGTTGTCAAGAGCAGAACTGTATTCTTCTTTACTTTAATAGAATTTATAAATTAACATATTTATTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10774
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Essential Splice Site 464 1047 12 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18652169)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17462746
GRCz11 12 17584620
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCACCACGTCCTTCATTGGCCCTCAACTGCCACCTCATATGCTGAAGG[T/A]AMTGCAAGACAATRAAACATCCTAGCAAAATCAGCACTGTGATGGATGTT
Long Flanking Sequence:
GTTCATTCTGGGTTCAGTTGCCACGCTGGACATTACTACTGCTACATTAAGGTATGTTGTCAAGAGCAGAACTGTATTCTTCTTTACTTTAATAGAATTTATAAATTAACATATTTATTTAATTGACCCTTTTATTTTAGGCTAGCAATGGGCAGTGGTATCAGATGAATGACTCGTCGGTATCTCTCAGCGATATAAGAACAGTTCTTAACCAACAAGCATACTTGCTCTTCTACATCAGGTAATATTCAAAATTCATTTGTCTCTTAAATGGGTAGTTAGTTGTATGAATGGAACTAAAAAAGATTCTGACAATTCATCAAAAAAATCTCCGTGTTAATTCAGGTCACCTGATGTAAAAAATGGAGGCGACTTTAGCCAGATGAACCATACTCCAGGTCAGTCTTCTCCAAGACCATCCATTCCACTCAAGATGAATGGGCCTCAGTATACCACCACGTCCTTCATTGGCCCTCAACTGCCACCTCATATGCTGAAGG[T/A]ACTGCAAGACAATGAAACATCCTAGCAAAATCAGCACTGTGATGGATGTTTTGAAAAATGTAGCTACAGGAAGAACTTTAAGTTATTTATTATATATCGGACTGAAAAATCATAAATGTAATTTTTTTTGTGTTACTGAATTATGAAGTTGTAATTACTATGTAATATGTTTTTATCTATATTAATCTTGCCATAAGTTCATAAGAAGGAACGTTCATAAGAATAAGTTCAGCCTTGATAAGCTTTTGTTTTTTCAATTTCTTCTGTTAAACTGGTCATTGTTTTTGCAGAACTCGTCATATGTTAATGGAAATGGTTCTTCAAAGGAATACCATGGTGGCTCTAAACCCAACAGAAATTTTGGTGGTGTGACCAAAATAGGCCCATCTCATACATCTTCCTCTGCATCTGCGTCCTCTTCTTCTTTGCCTGTTCGGTCCATGGGCATTCCAGATTCATCCAAAAGGCCGAAGCTGACGTTTCTCATTGGTCAAGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003375 Nonsense 857 1047 15 16
ENSDART00000134597 None None 74 None 4
Genomic Location (Zv9):
Chromosome 12 (position 18649251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17459828
GRCz11 12 17581702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAGGTGAGGACCGGAACAGAGGGTCAGATCGACCACATTTTTCTT[C/A]AACCCCGAAGGACAGGGAACGATACAGGCACTATAGGGATCATAGTGATA
Long Flanking Sequence:
ATCTTAATTTTTTGTGTCCTCAATCCGAGGCCATTTCTCATGTAATAAACTTCTTTTGGGTTTTCTTCATTCATTCAGAAGCTCCAATCCAGCAAGTTCTGATGACCATCCTTGTTCCTCACCTTCAAACAAAAGGTTGAACCTTCCTTCTGAGTCTTCATCTCAGTCTGTGGCACAGATACAATCTTCACCTAAAGAATCACTAGTCTTAAAGACTACAGATACTGACCTTCATACCGAGACCGCTTCTAAAGTTGAGTTGACTCAGAGGCATGCTACGCATACAGCAACTGGCACGTCAGACCTTCAGGTCAACAACAATGTTAGCCTTCATGTTAGTCATGGTCACACGAGTCCACACAAGTTAAAGGAGGTGTACAGGTGCAGTGAAGGAGAGAGCAAAGAGGCAAAACCATCACACTCAGACAAATTTGGCTCTGGAGATGGATGGAGGTCAGGTGAGGACCGGAACAGAGGGTCAGATCGACCACATTTTTCTT[C/A]AACCCCGAAGGACAGGGAACGATACAGGCACTATAGGGATCATAGTGATAGAAGCCGGAGTCGCTATGGGCACAGCTATCAAGATAGTCGTCGCTCCACCAGTAGAGAGCGCTATTATAGAGATCGAGATTTGGAGAGACACTGGGACAGATTCTCACACCACCGTCGAGAGCACCATTATTTCCAGAGAAGACACCGAGATGAACGCGACTGGAATAGAGATCGTAGGTTTGGGAGTGACTCTTATCGCCCTTCTGGATACCATAACAGGAATGGATATTCCAATCACAGTCATCGTGGGATGGAAGAGGCCCATGGAAGAGCGACTCATACAGTGAACGGTTCAAAAGGCAGGCCCTCGTCACCTCATTCCGTTAGTCCACTTCCTAGACATCACAAGCGGAAACGCAGTCCATCGGTTGATGCAAGGGAAAGTTCTGATGAGTGCAAAGCAAAGAAATCCAAAAAGAAAAAGAGAAACAAAGATAAACACAGGTAAG
Associated Phenotype:
Not determined