Busch Lab

ZMP

A5PLH8_DANRE

Ensembl ID:
ENSDARG00000077295
Description:
LOC100002625 protein [Source:UniProtKB/TrEMBL;Acc:A5PLH8]
Human Orthologue:
AKAP6
Human Description:
A kinase (PRKA) anchor protein 6 [Source:HGNC Symbol;Acc:376]
Mouse Orthologue:
Akap6
Mouse Description:
A kinase (PRKA) anchor protein 6 Gene [Source:MGI Symbol;Acc:MGI:3050566]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa42872 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36327 Nonsense Mutation detected in F1 DNA Not yet available
sa13083 Nonsense Available for shipment Available now
sa36328 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42872
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Essential Splice Site 112 2142 1 14
ENSDART00000109573 Essential Splice Site 112 304 2 4
Genomic Location (Zv9):
Chromosome 17 (position 8863690)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8861032
GRCz11 17 9018212
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAGGACAGCAGCAATAGACATGTGGATGTGCATCTGGTGCAACTCAAG[G/A]TAAGAATGCTTTAATACTCAATCCTGATTGGTCAGTTGTAGCATTGAGGT
Long Flanking Sequence:
ATTGATTGTGTGGAACCAAGCATTTTTTTTACAGTGTGTGTATTGTTTCTTAAACTAAAGTGTTACCCTTGTTTGTTTTTTAATCCCATTCTCATTTTTTTGTTTCTTTTTTCTAAACAGATAAACCAAAAGTCCCCATCCTCAGGATCCTATTACATTTCACCATGAACGTTGTCATATCACCAAATGCCAGTGAGGCTTCGTCCCCTATGATAACTGCAGTGACCCCAACCCTGGAACCGGGCCCTGATAAACATGATGATCCAGACGTGTGTGAACCCAGCGTTAGCGCTGATGGGTCGACCCAGAAACAAGATCCCTACCGCAGGTTCCAGAAACCTCCGCCTCTCCACACTGGGGCCGACTGGAAGGTGGTTCTCCATCTGCCGGAGATCGAGACCTGGCTGAGGACCACCACGGAGAGGGTCCGAGATCTCACACACTCTGTGCAGCAGGACAGCAGCAATAGACATGTGGATGTGCATCTGGTGCAACTCAAG[G/A]TAAGAATGCTTTAATACTCAATCCTGATTGGTCAGTTGTAGCATTGAGGTCTGAGATATTTTTGTGATGCTGTATTTAGGTTTGTTCACGGAAACACACCAGTGCTATAAGTGTTGTTCAAAAGTTTAGTGTTGAAATAAAAATTGAATTAAGTGAAGTTTATTCATAAACTATTTTAGAGATGATCACATACTTATGATTGATCACAGCTGGTCCCGCATTATTCAATTCATGATTCACCAATCAGACGATTCCTAAGGCTCTATAAATACCCTAAGTTTCATATAACAGCCATCTTTGTTTTGAAGAATCCCCCTTCCACTTCTACTCCTCCTCCTTTCCTAGATGGGTGACATGGTGACTCAGTGGTTAACACTGTTGCCTCACAGCATGAACGTCACTGGATCTAATCCTTACCAAGCCAGCCGACATTTCCGCGCAGAGTTTACATGTTCTCCATATGCTCACGTGGGTTCCCCGGTTTCCTACCACCATCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36327
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 801 2142 7 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 8988709)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8986051
GRCz11 17 9143231
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTGGGTTTGTTTTTTGGCGTCAGCAGGTGGAGGTCCAGCAGAGCCAT[C/T]GAGAGGCCCAGAAGGACATTCTGGATCAGATGAGAGGGAAACTTCAGAGT
Long Flanking Sequence:
CGTCTGACCTTTCTGGAGGCATCTGCCGAGCAGGCGGCGGGCGAGAACGCTCTTCATAAAGTGTTGAGAAATGAGCAAAAAATCAAAGCCGTCTGTTGGAGCTTTTTATTGGCTCGCTCATTCATCGGCTCGCATTTTGCACAATAACTGATCTCCGTCAAGCCAATGTAGCCAATTTTCTCAAGCACCGAGGAGAGATACATATTTTTTTCCATCTGATTTGAAAAAAAGCTTGTACAAGTGCTTCCTAATCGCTACTGAAAACCGACGCTCACCGCTGCTCGCTCCACGCCAGTTTTTATTGTTGCCATATTGATTTGGCTAAATGCTACGAGTCTGAATTGGTTTAATAGTTTCGCAAGTTTATTATGTTTTAATAGTTCTTGAAGTTGAATCAATGGCGTAGTGGTAATTGTTTTCCAAGGGGTCGCTGAAATTATAACGATTCCTTCTCTGGGTTTGTTTTTTGGCGTCAGCAGGTGGAGGTCCAGCAGAGCCAT[C/T]GAGAGGCCCAGAAGGACATTCTGGATCAGATGAGAGGGAAACTTCAGAGTCAACAGTTGTGGTCCGGCAGCAGAGGTGTCGACTTCAGTCTGATGTCCAGGACTAGCAGGTATGATTTAAAATGTGTTTAATCGATACCTTGTGAGAGCTGAAAACTCATTTAGGTTTTTATGCTAAACCTCACGTGTAGTTAAGGGCAAAATTGTTCGACCTCCTGTGAAATTTTCATTCTGTTTCAAATATTTTCCAAGCGCTGTTTAGCAGAGTTCACAGTATTTCCTTCACTAAAAAAAATGACATTTGCAGTTTATTTAAATTGAACAACATATTAAGTTCAATCTACTTCAATTTTTAAAAACTAAGTTTATTTAATTCCTTTATGTTATCCCAACACAAATTGTAAAACCCAGTATTTTTTACAGTGTATCTATATATTTTTTTTCTTACTATTTGGCTGGAATATTTAAAAATATATATTATAGGTATATATTATTAGCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28811
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Essential Splice Site 1086 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 9098732)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9096074
GRCz11 17 9253254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGAATTTATATGCCTTGTCATCTTCTTTTTTCTCTCTCTCTCTGCTGC[A/G]GGTCCCTGGGAACCTCATTGAGCCTTCGCTCATGGACCTCCATGGCCTGA
Long Flanking Sequence:
ATTACTTTGGTAATGACGTGACTAAAGGTTATAATTAGTCTATCTGATTAAAACGTTATGTGCTGCAATCGGGGTACAAATGTTAGCTGAGGCAGCTAACTGAAATTATTTTTATTTGATTAGACTGATTGATTGTTCTCACAGTTGAGGCTTTTTATCATGCGCTAGCAATCCAAGCCTGTGCATTAGTATTTTCCTCATCAGCAGAAAGAGAATAAACAGAAATCTAATAAAAATTCATTTAATGGGATATATGACATACAAAGCAAGTGTTAGATTTGCCAGTTTATTAGATTAATGAGATAAAGAGGATCATATAAATAGACTCTTCCCGCTTAAACAAGATGCAAAGCAATTTGTGTCATCATGCACTGCACTGAATGCCCATATCTATGCAAAAACGTGTTTGTCATAAATTAACTTGGCATTTGATCTAATTAAAAGTGCAATCAAGAATTTATATGCCTTGTCATCTTCTTTTTTCTCTCTCTCTCTGCTGC[A/G]GGTCCCTGGGAACCTCATTGAGCCTTCGCTCATGGACCTCCATGGCCTGACAGAAGACTCTTGGGAGTGGGACGAGATGGACATGACCATCAATATGGAGACGCAGAACTGTGAAGATGAGGAAACTCCTGGATCTAAATCACACCTTAATTCCCCAAAGGAGCCTTCGAGTCTCACTGAGTCATGCCCAACTGACACACAGTGCGCTCCATCTTCCCATGTTTATCAGGTGTACAGTCTGCATAACGTAGAACTCTATCAACAACCCCAATATAATCACAAATCATCTCCAGCCAAAGCGCAGCAATCACTGCTCAAGAGAGTGAGCATGGATTCATCCTTCTCCTCGGCTGAATCTCTACCTGATATCCTGGGAGACCTGCTGAGAGGGAAACAGAGGCTGCTATCAGATTCAGCCAGGAGATCAGAAAGCGAAAGTGGGATAGTAAGTGAAGGGGACACAGAGACCTTGGGTAACTCTGAAATTTGCCTGCTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13083
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1186 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 9099034)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9096376
GRCz11 17 9253556
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACTCTATCAACAACCCCAATATAATCACAAATCATCTCCAGCCAAAGCG[C/T]AGCAATCACTGCTCARGAGAGTRAGCATGGATTCATCCTTCTCCTCGGCY
Long Flanking Sequence:
ATAAAGAGGATCATATAAATAGACTCTTCCCGCTTAAACAAGATGCAAAGCAATTTGTGTCATCATGCACTGCACTGAATGCCCATATCTATGCAAAAACGTGTTTGTCATAAATTAACTTGGCATTTGATCTAATTAAAAGTGCAATCAAGAATTTATATGCCTTGTCATCTTCTTTTTTCTCTCTCTCTCTGCTGCAGGTCCCTGGGAACCTCATTGAGCCTTCGCTCATGGACCTCCATGGCCTGACAGAAGACTCTTGGGAGTGGGACGAGATGGACATGACCATCAATATGGAGACGCAGAACTGTGAAGATGAGGAAACTCCTGGATCTAAATCACACCTTAATTCCCCAAAGGAGCCTTCGAGTCTCACTGAGTCATGCCCAACTGACACACAGTGCGCTCCATCTTCCCATGTTTATCAGGTGTACAGTCTGCATAACGTAGAACTCTATCAACAACCCCAATATAATCACAAATCATCTCCAGCCAAAGCG[C/T]AGCAATCACTGCTCAAGAGAGTGAGCATGGATTCATCCTTCTCCTCGGCTGAATCTCTACCTGATATCCTGGGAGACCTGCTGAGAGGGAAACAGAGGCTGCTATCAGATTCAGCCAGGAGATCAGAAAGCGAAAGTGGGATAGTAAGTGAAGGGGACACAGAGACCTTGGGTAACTCTGAAATTTGCCTGCTGTGCCAGAGCGATGATTTAAAAGTTTGCGTTACCCTCACTCCTCCTATCAGAGAAGATTCACATAATAGAGACAGAGTCTCAGATGAGGACATAGACAGAGTTTTGGAGCGTGCCAACAAGTGCGCTGAATATGGTGACAGTCTTACCATTGTGAAGAGAGACCAGCGATGCCATGGCACGAGAAAGAAGAGAGATGATTGTGGAGAAAGCAGAAAGAAACATCGCAAGGAGCCTGTGAAGATCCTTGCCAAAGGCCTCGGGCTATGCCAAGAGTCTGGCGATGAAAATCCCAGCATGAGTGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36328
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1401 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 9099681)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9097023
GRCz11 17 9254203
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCCAACAAGCAAAGAGACACTCACTCGTAGCACTTCCCTAGAAAGTTG[G/A]CTTGCTCCGTGTAAGAGTGCAGAGGACGGGGGAAGTAAGGAAAGTCTGAG
Long Flanking Sequence:
AGTGAAGGGGACACAGAGACCTTGGGTAACTCTGAAATTTGCCTGCTGTGCCAGAGCGATGATTTAAAAGTTTGCGTTACCCTCACTCCTCCTATCAGAGAAGATTCACATAATAGAGACAGAGTCTCAGATGAGGACATAGACAGAGTTTTGGAGCGTGCCAACAAGTGCGCTGAATATGGTGACAGTCTTACCATTGTGAAGAGAGACCAGCGATGCCATGGCACGAGAAAGAAGAGAGATGATTGTGGAGAAAGCAGAAAGAAACATCGCAAGGAGCCTGTGAAGATCCTTGCCAAAGGCCTCGGGCTATGCCAAGAGTCTGGCGATGAAAATCCCAGCATGAGTGGAGATGATGAGAGAGTGACTACACACCGAAAGCTCCAAAAGGAGTTTGCACAGCTCTCCCAGGGGTCTTCCCTAGACTCCCTTTATGCAGTGGGAGAACTGTTCCCAACAAGCAAAGAGACACTCACTCGTAGCACTTCCCTAGAAAGTTG[G/A]CTTGCTCCGTGTAAGAGTGCAGAGGACGGGGGAAGTAAGGAAAGTCTGAGGGACATCGGATCGACTGTGGAGCCCACTGGGGAACTCAGCAGAAGAACTCTAGAGCTTCTGAAACGCCTTGAGAACATCCAAAGCCCACTCGCTCTGAAGATGACGCGCAGTGTGTCTGACGTAACGCTCCAGAGCAGCTCACTGTGGCGTGGGTCACGCTCGGCTGGCGCTCCCTCCTCCATTAACGAGAGCTCGGCAGCCTCCCTGACAGAGCTGAGCAGCACTGAAGACTCCTCGGTGGCATCCGAAGACTTAGCCGTGCAAATGAACCGCTGCATAGCTGCTGAATCCAATGCTTCCTTCCGAAAACATTGCCACAGCCAGCAACAAGCGGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCATGCACATCAGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTTTGACTCTCACCGAAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19161
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 9100115)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9097457
GRCz11 17 9254637
KASP Assay ID:
2261-0668.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCATGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTT
Long Flanking Sequence:
TGCAGTGGGAGAACTGTTCCCAACAAGCAAAGAGACACTCACTCGTAGCACTTCCCTAGAAAGTTGGCTTGCTCCGTGTAAGAGTGCAGAGGACGGGGGAAGTAAGGAAAGTCTGAGGGACATCGGATCGACTGTGGAGCCCACTGGGGAACTCAGCAGAAGAACTCTAGAGCTTCTGAAACGCCTTGAGAACATCCAAAGCCCACTCGCTCTGAAGATGACGCGCAGTGTGTCTGACGTAACGCTCCAGAGCAGCTCACTGTGGCGTGGGTCACGCTCGGCTGGCGCTCCCTCCTCCATTAACGAGAGCTCGGCAGCCTCCCTGACAGAGCTGAGCAGCACTGAAGACTCCTCGGTGGCATCCGAAGACTTAGCCGTGCAAATGAACCGCTGCATAGCTGCTGAATCCAATGCTTCCTTCCGAAAACATTGCCACAGCCAGCAACAAGCGGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCATGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTTTGACTCTCACCGAAGAGGAGCTTGGTATTAAAGATGATGACTCTAGTGTAACCTCAGAGGAAGAGTACATCGAAGGCTCCTTCGCTCTTGGGTTGGATTACATAAAGGGTGAGTTTCAAAGCTGGATGAAGCCTCGATCTCAGATTAGAGAGAAAAACGAGGCAGATCTGGTGGATGAACTGCAGTGTGGCACCCTGTCTAGAGACATCCTGTCACCTATTAAGACTGCCAGCGATCGGCAGTTTCTCAGCAGATCTGCATTGAGGCTCCTGGAAGCCAACACTAATGCTAAAAACGAGAGTCTCAAGCACCGGGAGGTGGATGGGAACCGCCGGGATGCCACCAGGAACTATATCAGCTGCTTTGTGGATGATATGGAAAACGGCAATGTCGAGAGCTCTCACATCAAAGCCAAAGACGAAGATGATGAGCTGCTGAGGGAGGAGGGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7821
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
ENSDART00000105333 Nonsense 1546 2142 12 14
ENSDART00000109573 None None 304 None 4
Genomic Location (Zv9):
Chromosome 17 (position 9100115)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9097457
GRCz11 17 9254637
KASP Assay ID:
2261-0668.1 (used for ordering genotyping assays)
KASP Sequence:
GGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCWTGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTT
Long Flanking Sequence:
TGCAGTGGGAGAACTGTTCCCAACAAGCAAAGAGACACTCACTCGTAGCACTTCCCTAGAAAGTTGGCTTGCTCCGTGTAAGAGTGCAGAGGACGGGGGAAGTAAGGAAAGTCTGAGGGACATCGGATCGACTGTGGAGCCCACTGGGGAACTCAGCAGAAGAACTCTAGAGCTTCTGAAACGCCTTGAGAACATCCAAAGCCCACTCGCTCTGAAGATGACGCGCAGTGTGTCTGACGTAACGCTCCAGAGCAGCTCACTGTGGCGTGGGTCACGCTCGGCTGGCGCTCCCTCCTCCATTAACGAGAGCTCGGCAGCCTCCCTGACAGAGCTGAGCAGCACTGAAGACTCCTCGGTGGCATCCGAAGACTTAGCCGTGCAAATGAACCGCTGCATAGCTGCTGAATCCAATGCTTCCTTCCGAAAACATTGCCACAGCCAGCAACAAGCGGATGAGACAGATGCTAGTATCAGTATGGTTGTTAACATTTCATGCACAT[C/A]AGCCTGCACCGACGATGAAGAAGACAGCGATCTTCTCTCCAGCTCCACTTTGACTCTCACCGAAGAGGAGCTTGGTATTAAAGATGATGACTCTAGTGTAACCTCAGAGGAAGAGTACATCGAAGGCTCCTTCGCTCTTGGGTTGGATTACATAAAGGGTGAGTTTCAAAGCTGGATGAAGCCTCGATCTCAGATTAGAGAGAAAAACGAGGCAGATCTGGTGGATGAACTGCAGTGTGGCACCCTGTCTAGAGACATCCTGTCACCTATTAAGACTGCCAGCGATCGGCAGTTTCTCAGCAGATCTGCATTGAGGCTCCTGGAAGCCAACACTAATGCTAAAAACGAGAGTCTCAAGCACCGGGAGGTGGATGGGAACCGCCGGGATGCCACCAGGAACTATATCAGCTGCTTTGTGGATGATATGGAAAACGGCAATGTCGAGAGCTCTCACATCAAAGCCAAAGACGAAGATGATGAGCTGCTGAGGGAGGAGGGAA
Associated Phenotype:
Not determined