Busch Lab

ZMP

SYNPO2L (2 of 2)

Ensembl ID:
ENSDARG00000077293
Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Human Orthologue:
SYNPO2L
Human Description:
synaptopodin 2-like [Source:HGNC Symbol;Acc:23532]
Mouse Orthologue:
Synpo2l
Mouse Description:
synaptopodin 2-like Gene [Source:MGI Symbol;Acc:MGI:1916010]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22279 Nonsense Available for shipment Available now
sa35468 Nonsense Mutation detected in F1 DNA Not yet available
sa31924 Nonsense Available for shipment Available now
sa24931 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22279
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 360 932 6 11
Genomic Location (Zv9):
Chromosome 13 (position 22399181)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22128519
GRCz11 13 22258969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATGGCATATTTCCTGGCAGTGAATCAGAATTTGATGAGGAGGGTTTTT[C/A]AGCTGCACCGGACCCCACATGGGACAGCGACTACCTTGAAATGCTGGAGA
Long Flanking Sequence:
TACTCATATCGGTTGTAAAAAAGTGTTATCGGTTCATCCCTACATTATCCCTAAATTAAAATTTCAGCACTAGTAAACAAAGACTTTCCCAATGGTAGACAAATCATTTTTGCATCAAAGTTATATTATTAATTTAACCATGCTTCCTTGTTGCAAAATTCTTTAACTAAAACGCGGTTGCTGTTAAATATTTGTAATATATATATATACTGTCTCAAACCTTTTTATCTTATGTTATGCAGAATTGAACCGTGGAGAGACAATCACAGACAAGCAGGTGAAAGAGGCCCGGTCCAAGTGCCGCACAATCGCCTCACTACTGACAGATGCACCAAACCCTCATTCAAAGGGTGTACTGATGTTTAAAAAGCGCCGGCAACGATCCAAGAAATATACACTGACCAGCTTTGGAAGTGTTGATGAGGACATGAGGCAGGACTCTCAAGAGGAGGATGGCATATTTCCTGGCAGTGAATCAGAATTTGATGAGGAGGGTTTTT[C/A]AGCTGCACCGGACCCCACATGGGACAGCGACTACCTTGAAATGCTGGAGAAAAGATGTGCTTCCAGAGGTCAGGAAGGAGATGGTGGTGCTCTTAGTCCTGGTCTGAGTGATACATCTGGAAAGGGGGCACAGTTGTTTGAGCAGCAGAGGAAAAGGGCTGAAGAGCATGCAAGAAAAATCGAAGCTGCACAAGAACAGTTACAAAGCCAAATGCTGGGCATTTCACTGAAAGAGGCCCAGGCACTTCCTCCGCTTCAGACAGCACACCCAGACCCACTAACAAAGCTCAATGTCCAGCCACCACCAGTTGCTCCAAAACCTGCCAGACCTTCAACAACCCTTTATCATGACGTTCAAGCAGCCGAAGCACAAAACAACAAGACACAGATGAATACACCTCAGACCATCCCCACTGTTCCTGTTATGGTGAATGGAGATGCTTCGAACACAACTGTGACAGCCCCCTCTGTGATGCCCAAAACTAATCTCTCAGTTCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa604
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 426 932 6 11
Genomic Location (Zv9):
Chromosome 13 (position 22399378)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22128716
GRCz11 13 22259166
KASP Assay ID:
554-0514.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGGAAAAGGGCTGAAGAGCATGCAAGRAAAATCGAAGCTGCACAAGAA[C/T]AGTTACAAAGCCAAATGCTGGGCATTTCACTGAAAGAGGCCCAGGCACTT
Long Flanking Sequence:
TATATATATATACTGTCTCAAACCTTTTTATCTTATGTTATGCAGAATTGAACCGTGGAGAGACAATCACAGACAAGCAGGTGAAAGAGGCCCGGTCCAAGTGCCGCACAATCGCCTCACTACTGACAGATGCACCAAACCCTCATTCAAAGGGTGTACTGATGTTTAAAAAGCGCCGGCAACGATCCAAGAAATATACACTGACCAGCTTTGGAAGTGTTGATGAGGACATGAGGCAGGACTCTCAAGAGGAGGATGGCATATTTCCTGGCAGTGAATCAGAATTTGATGAGGAGGGTTTTTCAGCTGCACCGGACCCCACATGGGACAGCGACTACCTTGAAATGCTGGAGAAAAGATGTGCTTCCAGAGGTCAGGAAGGAGATGGTGGTGCTCTTAGTCCTGGTCTGAGTGATACATCTGGAAAGGGGGCACAGTTGTTTGAGCAGCAGAGGAAAAGGGCTGAAGAGCATGCAAGAAAAATCGAAGCTGCACAAGAA[C/T]AGTTACAAAGCCAAATGCTGGGCATTTCACTGAAAGAGGCCCAGGCACTTCCTCCGCTTCAGACAGCACACCCAGACCCACTAACAAAGCTCAATGTCCAGCCACCACCAGTTGCTCCAAAACCTGCCAGACCTTCAACAACCCTTTATCATGACGTTCAAGCAGCCGAAGCACAAAACAACAAGACACAGATGAATACACCTCAGACCATCCCCACTGTTCCTGTTATGGTGAATGGAGATGCTTCGAACACAACTGTGACAGCCCCCTCTGTGATGCCCAAAACTAATCTCTCAGTTCTTTCTACAGAAACTGTGATGCCTCCACCACCAACTCCTCTACCAGAACTTCCTGCCAGTTCTGTGTTAAACAGAACTGCCAGACCTTTTGCCCCAGGCTGCATTACCAATCGGGCAGCCACTGCTCCTGTTGTGTTTCGCCCTGCAGTCAGTAAGAAGACACCTAGACCTGTTTCAGTGGCTGTGGTGGCACCTCCATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4499
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Essential Splice Site 472 932 7 11
Genomic Location (Zv9):
Chromosome 13 (position 22399722)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22129060
GRCz11 13 22259510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTTCTTTCTACAGAAACTGTGATGCCTCCACCACCAACTCCTCTACC[A/T]GAACTTCCTGCYAGYTCTGTGTTAAACAGAACTGCCAGACCTTTTGCCCC
Long Flanking Sequence:
ATGCTGGAGAAAAGATGTGCTTCCAGAGGTCAGGAAGGAGATGGTGGTGCTCTTAGTCCTGGTCTGAGTGATACATCTGGAAAGGGGGCACAGTTGTTTGAGCAGCAGAGGAAAAGGGCTGAAGAGCATGCAAGAAAAATCGAAGCTGCACAAGAACAGTTACAAAGCCAAATGCTGGGCATTTCACTGAAAGAGGCCCAGGCACTTCCTCCGCTTCAGACAGCACACCCAGACCCACTAACAAAGCTCAATGTCCAGCCACCACCAGTTGCTCCAAAACCTGCCAGACCTTCAACAACCCTTTATCATGACGTTCAAGCAGCCGAAGCACAAAACAACAAGACACAGATGAATACACCTCAGACCATCCCCACTGTTCCTGTTATGGTGAATGGAGATGCTTCGAACACAACTGTGACAGCCCCCTCTGTGATGCCCAAAACTAATCTCTCAGTTCTTTCTACAGAAACTGTGATGCCTCCACCACCAACTCCTCTACC[A/T]GAACTTCCTGCCAGTTCTGTGTTAAACAGAACTGCCAGACCTTTTGCCCCAGGCTGCATTACCAATCGGGCAGCCACTGCTCCTGTTGTGTTTCGCCCTGCAGTCAGTAAGAAGACACCTAGACCTGTTTCAGTGGCTGTGGTGGCACCTCCATTTCCAGCAGCATCAGAAGAGCATGTCATGTGTGTCACCCCAGCCATATTTGGTACCCAAGTAACAATGAGTCAAATGAATGCCAATGTCTCTAATGAAATAATACCCACACAGCCCTTGGCACAAGGAACGTCTATTCCTCCACCTGCTGCTGTATCAGTTGAATCATATTCTCAACCTGCTTTTCAGTGCTCTGCAATGGAAAGCATCCAGGTTGCATCACTTCCCAGAGTTCAAGCCCAAAAGCCTACTGTTCCAATGATTGCAGAAACAATAGTTCCTCCTGATGACATGGTGACTTCTTTGGCTACTGATATGCATCCTAAGGGTATAACAATATCATCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35468
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 617 932 8 11
Genomic Location (Zv9):
Chromosome 13 (position 22400302)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22129640
GRCz11 13 22260090
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAGACAACTTCAAGCCCTGTAATTCCACTGTCACCTGTAGTCTATCGT[G/T]AAAAACCAGCTTCTGTTGGTGGCCGCACTGGTATTCTCCAAGATGCCCGA
Long Flanking Sequence:
CTCCTGTTGTGTTTCGCCCTGCAGTCAGTAAGAAGACACCTAGACCTGTTTCAGTGGCTGTGGTGGCACCTCCATTTCCAGCAGCATCAGAAGAGCATGTCATGTGTGTCACCCCAGCCATATTTGGTACCCAAGTAACAATGAGTCAAATGAATGCCAATGTCTCTAATGAAATAATACCCACACAGCCCTTGGCACAAGGAACGTCTATTCCTCCACCTGCTGCTGTATCAGTTGAATCATATTCTCAACCTGCTTTTCAGTGCTCTGCAATGGAAAGCATCCAGGTTGCATCACTTCCCAGAGTTCAAGCCCAAAAGCCTACTGTTCCAATGATTGCAGAAACAATAGTTCCTCCTGATGACATGGTGACTTCTTTGGCTACTGATATGCATCCTAAGGGTATAACAATATCATCCCAAACCTCTTCTATTTTGACCCCTACTGCTTCTGAGACAACTTCAAGCCCTGTAATTCCACTGTCACCTGTAGTCTATCGT[G/T]AAAAACCAGCTTCTGTTGGTGGCCGCACTGGTATTCTCCAAGATGCCCGACGCCGCAGTGCATACAAGCCAATGTTTAAGATGCCTGACAGCAAGAAGAACTCACCAAACCCTGAACTGTTGACTATGGTGCAGAACCTAGATGACAGACCCAGCCATGGGTATCCTGAACCAGACAATATTGTTTACAACATTGATGAAAATAGGACAAGGGTCCCACCACCTGTGGCTCCTAAGCCACGAGTCATCCCAGAAATGTCACAGATCCCTCAGGCAGAGGGAAAAGGTGCAGAGCTGTTTGCTCGTAGACAAAGCCGCATGGATCAGTTTGTTGTAGACACTCCATATCTGCAGCCAGCAACTCTACAACACCAACAATCCCAATCAGTCATAGATTTCATCCAACCTCGAGAACCCTCGCCAACCCCATCCCAATGGAAGTATTCCCCTAATGTTCGGGCTCCTCCACCCATAGGATACAATCCCTTGTTGTCTCCTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31924
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Nonsense 749 932 9 11
Genomic Location (Zv9):
Chromosome 13 (position 22400745)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22130083
GRCz11 13 22260533
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTCATCCAACCTCGAGAACCCTCGCCAACCCCATCCCAATGGAAGTA[T/G]TCCCCTAATGTTCGGGCTCCTCCACCCATAGGATACAATCCCTTGTTGTC
Long Flanking Sequence:
ACTGCTTCTGAGACAACTTCAAGCCCTGTAATTCCACTGTCACCTGTAGTCTATCGTGAAAAACCAGCTTCTGTTGGTGGCCGCACTGGTATTCTCCAAGATGCCCGACGCCGCAGTGCATACAAGCCAATGTTTAAGATGCCTGACAGCAAGAAGAACTCACCAAACCCTGAACTGTTGACTATGGTGCAGAACCTAGATGACAGACCCAGCCATGGGTATCCTGAACCAGACAATATTGTTTACAACATTGATGAAAATAGGACAAGGGTCCCACCACCTGTGGCTCCTAAGCCACGAGTCATCCCAGAAATGTCACAGATCCCTCAGGCAGAGGGAAAAGGTGCAGAGCTGTTTGCTCGTAGACAAAGCCGCATGGATCAGTTTGTTGTAGACACTCCATATCTGCAGCCAGCAACTCTACAACACCAACAATCCCAATCAGTCATAGATTTCATCCAACCTCGAGAACCCTCGCCAACCCCATCCCAATGGAAGTA[T/G]TCCCCTAATGTTCGGGCTCCTCCACCCATAGGATACAATCCCTTGTTGTCTCCTTCCTGTCCTGTTGGGGTGCAGCGTGCAGGCGCAAAGGTGTCTGAGGGAAGCGCCAAAGGAAGTAAGGGTAGTTATGGTGTGCCAAAAGAGGGTATCAAGGCCTTGGATTTCATGAGAAGGCAGCCATACCAGCTAAACCCTGCAATGTTCAGTTTTGGTGGTGGCATTGGTACACAGTCTTCAATCCCTTCCTACCAGAGGCAGCAGAGGGAGGGCCACACTCTGACTCCACCCAAGCAGATCCCAGTAAAGGCGGCACGTGTGTATGAAATCAAAAGATTCTCTACTCCCACCCCAATGTCAGCACCAACTCTCAACCCCACAGTCATTATACCACGCTCACAGACCACCCTTGGTGAGCGAATCTCTCGTTCTGACATGACTTCCCCTGCACCTGAACCTGTCCCTGAATCATCTCTAGCACCTTCACGGGCCCCAGGCCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108472 Essential Splice Site 888 932 11 11
Genomic Location (Zv9):
Chromosome 13 (position 22401360)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22130698
GRCz11 13 22261148
KASP Assay ID:
554-7452.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTCAAGTATGTCAAATCTCAGCTACTCTGGGCTCCAAGCTGCCAAACA[G/A]TTTAAGAGTGCCCCTGAATTAAGTGCCTTACCACCAAATCCCTTAAAATC
Long Flanking Sequence:
AGTAAGGGTAGTTATGGTGTGCCAAAAGAGGGTATCAAGGCCTTGGATTTCATGAGAAGGCAGCCATACCAGCTAAACCCTGCAATGTTCAGTTTTGGTGGTGGCATTGGTACACAGTCTTCAATCCCTTCCTACCAGAGGCAGCAGAGGGAGGGCCACACTCTGACTCCACCCAAGCAGATCCCAGTAAAGGCGGCACGTGTGTATGAAATCAAAAGATTCTCTACTCCCACCCCAATGTCAGCACCAACTCTCAACCCCACAGTCATTATACCACGCTCACAGACCACCCTTGGTGAGCGAATCTCTCGTTCTGACATGACTTCCCCTGCACCTGAACCTGTCCCTGAATCATCTCTAGCACCTTCACGGGCCCCAGGCCTCCCAGAGCTCCCCAAAATTTCATCTGTGCCCATCCCTCACCCCATGCCATACTCTCCACCAGTTCCCATCTCAAGTATGTCAAATCTCAGCTACTCTGGGCTCCAAGCTGCCAAACA[G/A]TTTAAGAGTGCCCCTGAATTAAGTGCCTTACCACCAAATCCCTTAAAATCCCCTATCCAAGTTCCCAAACCACACTTTATTGCAACACGGGCGGGTGTACAGCCCCGCGTCTGGAGGCCTGGTACCTTACCTCACTGACAGTATTGCTTTGCATGTGAAAGACTGAAACATCTATATCTGTCTCAAAGTTAAATCCTTTCAAGTTTGATCAGTGAGGTAACATTAATTTATTTGGAAACTATAAGGGAATAATATGTGCTGCATCCCAATTTGCATACTATCCATCTGGAATTGTATTTAATAGTTTGTACCAACTCGTAGTATTGAAATGAGTGTGCTAAAGGTTTCCAATTGAATTGTAATTTGAAGTGTAGAACCGTCTGGTCACTACAAAAATTGGTAAAAAGTGCAAACAAGCTACAAAAATTTAAATCACGTTATCTGTGTTATAGTTTATCTGCAACAGAAATGTGTACTTCTATAAAGATGTGTTTTGACAT
Associated Phenotype:
Not determined