Busch Lab

ZMP

MMP25 (1 of 2)

Ensembl ID:
ENSDARG00000077290
Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Human Orthologue:
MMP25
Human Description:
matrix metallopeptidase 25 [Source:HGNC Symbol;Acc:14246]
Mouse Orthologue:
Mmp25
Mouse Description:
matrix metallopeptidase 25 Gene [Source:MGI Symbol;Acc:MGI:2443938]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11222 Essential Splice Site Available for shipment Available now
sa17999 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26096
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110611 Essential Splice Site 36 576 1 10
Genomic Location (Zv9):
Chromosome 3 (position 32757659)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32488969
GRCz11 3 32620683
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTGCGCGCGACCCGCGTTGATGCCTGACCAGTATGCTCGAGGAGTG[G/A]TATGGATATTCTCCCCTCTTTAGAGTGTGTGTGGTTTAACCTTATACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11222
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110611 Essential Splice Site 80 576 2 10
Genomic Location (Zv9):
Chromosome 3 (position 32758116)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32489426
GRCz11 3 32621140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCCGCAAAATGCAACGATTTGCTGGCATCGAAGAGACTGGGAACTTGG[G/A]TAACAGTTTATTATTGCACCCACAGTTGAGGACACAATTATTAGCCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17999
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110611 Nonsense 509 576 10 10
Genomic Location (Zv9):
Chromosome 3 (position 32765452)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32496762
GRCz11 3 32628476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGCATTTCCCTCAGGAGAAACCTACTTTTTYAAAGACTCAAACTACTG[G/A]ATTTTACAAAGAGGAGGTCTGGATCTGGAATCTGCTTCTCCGAAGTCTAT
Associated Phenotype:
Not determined