Busch Lab

ZMP

scarf1

Ensembl ID:
ENSDARG00000077285
ZFIN ID:
ZDB-GENE-030131-8778
Human Orthologue:
SCARF1
Human Description:
scavenger receptor class F, member 1 [Source:HGNC Symbol;Acc:16820]
Mouse Orthologue:
Scarf1
Mouse Description:
scavenger receptor class F, member 1 Gene [Source:MGI Symbol;Acc:MGI:2449455]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa10051 Nonsense Available for shipment Available now
sa13509 Nonsense Available for shipment Available now
sa42563 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10051
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110969 None None 425 None 3
ENSDART00000138401 Nonsense 408 870 7 10
Genomic Location (Zv9):
Chromosome 15 (position 27566079)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28284319
GRCz11 15 28217195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTGTGTTTTTCTWCTAGGTAGCAGAGCTGGTCTTTTAGCAGGGCTTT[T/A]GATTCCTCTCTGCATATTAATACTCGCCTTGTTGKTCTGCTGCTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3939
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110969 Nonsense 14 425 1 3
ENSDART00000138401 Nonsense 459 870 8 10
Genomic Location (Zv9):
Chromosome 15 (position 27563123)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28281363
GRCz11 15 28214239
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGTCCGCATGAAGCACCATGTTTATACTGTGTTGGCCAACATGGGTT[C/A]AGCAATGCCTTGCATCACTCTTTGGTCATCTGGTTTGCCCAGGGTTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110969 Nonsense 64 425 2 3
ENSDART00000138401 Nonsense 509 870 9 10
Genomic Location (Zv9):
Chromosome 15 (position 27562856)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28281096
GRCz11 15 28213972
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCATCATCCGGCTGGGTAATAGATTCATTCGAAACTGATGAGGATGGA[G/T]AAGCTGTTTACTGCGAACCACCCAGGGAAGGTAAAGCAGTTTATCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110969 Essential Splice Site 74 425 2 3
ENSDART00000138401 Essential Splice Site 519 870 9 10
Genomic Location (Zv9):
Chromosome 15 (position 27562824)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28281064
GRCz11 15 28213940
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACTGATGAGGATGGAGAAGCTGTTTACTGCGAACCACCCAGGGAAGG[T/C]AAAGCAGTTTATCTCAGTATTTTTAATTTCACTGTCACTGTATCTATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110969 Nonsense 282 425 3 3
ENSDART00000138401 Nonsense 727 870 10 10
Genomic Location (Zv9):
Chromosome 15 (position 27560173)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28278413
GRCz11 15 28211289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGGCCTGTTCAGGCGATGCTGCGCAGACTAGGAAGCCTCCAGAGGCAA[A/T]AAGAAGAAGTTGCTAAAGGSAAGGCCCAATCGATTGTTAAGCCTCCACGR
Associated Phenotype:
Not determined