Busch Lab

ZMP

si:ch211-30e10.2

Ensembl ID:
ENSDARG00000077284
ZFIN ID:
ZDB-GENE-091204-253
Human Orthologue:
GDPD5
Human Description:
glycerophosphodiester phosphodiesterase domain containing 5 [Source:HGNC Symbol;Acc:28804]
Mouse Orthologue:
Gdpd5
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:2686926]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa4387 Essential Splice Site F2 line generated Not yet available
sa12711 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4387
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111234 Essential Splice Site 443 595 12 15
ENSDART00000133914 None None 316 None 9
ENSDART00000141260 Essential Splice Site 53 205 2 5
Genomic Location (Zv9):
Chromosome 10 (position 39807315)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38497286
GRCz11 10 38441044
KASP Assay ID:
554-3588.1 (used for ordering genotyping assays)
KASP Sequence:
GTAATGCTGMGCCATTTTTCTTTCTCTCTCTCTCTCTTGTTGTGTTGAGC[A/T]GGCAGTTCTCTGTCAGTAATGTGAGTGTAAACGTGTATCCKGTGAACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12711
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111234 Nonsense 580 595 15 15
ENSDART00000133914 None None 316 None 9
ENSDART00000141260 Nonsense 190 205 5 5
Genomic Location (Zv9):
Chromosome 10 (position 39799410)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38489381
GRCz11 10 38433139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAGCACAGACGAGCTCTCCGCGTTCACGGGAAACGGCCTGGAYGTGTA[C/A]ACGCATGATGACATCATGAYGCCCGCGCGACATACCGCCAAACTATAGAC
Associated Phenotype:
Not determined