Busch Lab

ZMP

sb:cb986

Ensembl ID:
ENSDARG00000077270
ZFIN IDs:
ZDB-GENE-031116-23, ZDB-GENE-031116-23
Description:
LOC572121 protein [Source:UniProtKB/TrEMBL;Acc:A5PL99]
Human Orthologue:
INCENP
Human Description:
inner centromere protein antigens 135/155kDa [Source:HGNC Symbol;Acc:6058]
Mouse Orthologue:
Incenp
Mouse Description:
inner centromere protein Gene [Source:MGI Symbol;Acc:MGI:1313288]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25220 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa19355 Nonsense Mutation detected in F1 DNA Not yet available
sa10414 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4303
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610 Nonsense 274 331 4 7
ENSDART00000114694 None None 324 None 9
ENSDART00000121440 Nonsense 274 759 3 21
Genomic Location (Zv9):
Chromosome 25 (position 3577453)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3525617
GRCz11 25 3651351
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCCGGCGMTCTTTCCTGAAGAAGAAAGCCAGACTGGGAAACTCCACCTG[C/A]AGCAGCTCCGTCAGCGGTAAGWCTAGCTCCTACATCTATAAATCRCCAGC
Long Flanking Sequence:
GTTACGCCGCACGTCCCGAACGACAGCTCAGAAAGCCTCACCGAGGAACCTGCTCGTCGCACACGCCGCAACAAAACCGCCGCTCCAGCTGAACCTGAACCCATCAAACGCAGCACCCGCAACAAAGCTGCCACCAAAGCCGAGGAAGAAGTAGTGGAGGAAGTTCCAGAAGTGAAACAAGCCTGTGAGGATTCAACATCCAATAAAGATCAGCTCCTGGTGTCTGCTGCTGTTGTGAAGATTCCCTCCTCGGAGCGTCTGAGTGCGGAGTCGCTGCTGAACAGCGGTCAGTCTCCTGGAAGATCTGCTAATAAAATCCCCATCGCTGCGTCTGGGCTGCAGAACACTCCTCAGGGATCTTCTCGGACATCAGCTCGCAGGTCTCTGGTGGTGCGACGCTCGCTTGTCGGACTCAGGCATAGCATGACTCAGGAAGCTGTTCGCAGGGCGTCCCGGCGATCTTTCCTGAAGAAGAAAGCCAGACTGGGAAACTCCACCTG[C/A]AGCAGCTCCGTCAGCGGTAAGACTAGCTCCTACATCTATAAATCGCCAGCTCTGTGTGAACCTGGTTATATGATTCAGTTTGGTCAATTGGATTTCGAGGAAATGAGGTTGCTGTTTATACATTGTGTTTTAATATGTAAAGCTGAACCACAAAATATTCATGGGTATAGTTTTGGCAGTAGGCACCAATATGTTGAATTGGTCAAAATATTTGATTTTCCTTTTATGCCAAAAATGATTAGAATATGAATTGAAAATTCTTTCATTTTCTTCCGTAAATATATCAACTTCATTTTTTTTTCAATAAAACATTATTTGCAAAAGTATTTGAAAAACAGAGTCAAATGATCTTTGCTCCAACAGAGCCCCCCACTCCTCAGCACCATTTATAAACAATATGTTATGCCCATTTTTAATCTGTTTTACATTCTGTCGCAATATATACATACATACATACAATACAAATAGACAAAAGTTCCATTATATGTTCACTCATCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610 None None 331 None 7
ENSDART00000114694 Nonsense 18 324 2 9
ENSDART00000121440 Splice Site None 759 None 21
Genomic Location (Zv9):
Chromosome 25 (position 3563909)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539071
GRCz11 25 3664640
KASP Assay ID:
554-7715.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTAGGAAACGGGACGAGCGTTTGAAACGGGTTGTAGAGGCTCGAGTG[A/T]AAAGCGAAAAGGAGAAGGAGCAGGAAAAGAAAAAGAAGATCGAAGAAAAG
Long Flanking Sequence:
GCGATTTTACGGCTGTTTCCTTTTTTTAGAGAGAGAGAAAGTAGTTTCATTTATCATGCACTTGTTTTTGATACATTTATGTTGAAGGACAGCTACATTACAAACAGCAGATTAGTTTTTTTTTTTTTTTTACTCCATATGGCCCTTTTTTTTAATCCCTATAATTTTTTTAACCCTTGACATTACAAATGCCAATTTAGATTTTTTTTTTTATCCCATATGACTCATTATTAGATTTTCTTTTTCCCAAATGACCTTTTTTAACCCATATGATTTTTAACCCATGACATTACAAAGGCAAATAAATTTTTTTAAATTTATTTTTATTTTACTCATAGTATTTTTTTAAACGCATGACATTACAAATGGCAAATTCGATTTATTTATTTTAACCCATATGACCTGTTCTTTAAGTGTGAATGCAAAAGTATACTCAAAAGTCGATTGTGAATTTTAGGAAACGGGACGAGCGTTTGAAACGGGTTGTAGAGGCTCGAGTG[A/T]AAAGCGAAAAGGAGAAGGAGCAGGAAAAGAAAAAGAAGATCGAAGAAAAGATGGCACAGCTGGAGAAGAAAAACGACCTGGTCAGTGCTGAAGATCTTTAGACTCAATGTAGACCCATGCACTCCACTTGATTTGGATTCTTCATAAAGCTCTTGTTTTTCTCTAAGCTGCGAGTGGAGCGGATGGCGGAGGAGAAAGCCAAGAGGAAGGTGGCCACTAAACGACAGGAAGAACTGGAGCTGCGCAGGAAACAGGAAGAGGCGGCGAGACAAAAGAAACAGCAGCAAGTTGTAAGTCAATCCTGCAATAAAAGGTGCTATTTGGACCTGGTGTTAACATGCGTTCAGATTCATGGTTCTGTTTGGTGTAATGCACGAGGACTGAATGAATTGCGTACGTGATCTAAAACAAGTGAATTTGAAGAAAGTAAATATGGAAAATCTTGACATTGCGATATTTTGTTTTGCTATCTAAGGGTGCTTTCACACCTGCCTTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19355
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610 None None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
ENSDART00000114610 None None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
Genomic Location (Zv9):
Chromosome 25 (position 3563624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539356
GRCz11 25 3664925
KASP Assay ID:
554-6222.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGCGCAGGAAACAGGAAGAGGCGGCGAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCTGCAATAAAAGGTGCTATTTGGACCTGGTGTTA
Long Flanking Sequence:
GACATTACAAAGGCAAATAAATTTTTTTAAATTTATTTTTATTTTACTCATAGTATTTTTTTAAACGCATGACATTACAAATGGCAAATTCGATTTATTTATTTTAACCCATATGACCTGTTCTTTAAGTGTGAATGCAAAAGTATACTCAAAAGTCGATTGTGAATTTTAGGAAACGGGACGAGCGTTTGAAACGGGTTGTAGAGGCTCGAGTGAAAAGCGAAAAGGAGAAGGAGCAGGAAAAGAAAAAGAAGATCGAAGAAAAGATGGCACAGCTGGAGAAGAAAAACGACCTGGTCAGTGCTGAAGATCTTTAGACTCAATGTAGACCCATGCACTCCACTTGATTTGGATTCTTCATAAAGCTCTTGTTTTTCTCTAAGCTGCGAGTGGAGCGGATGGCGGAGGAGAAAGCCAAGAGGAAGGTGGCCACTAAACGACAGGAAGAACTGGAGCTGCGCAGGAAACAGGAAGAGGCGGCGAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCTGCAATAAAAGGTGCTATTTGGACCTGGTGTTAACATGCGTTCAGATTCATGGTTCTGTTTGGTGTAATGCACGAGGACTGAATGAATTGCGTACGTGATCTAAAACAAGTGAATTTGAAGAAAGTAAATATGGAAAATCTTGACATTGCGATATTTTGTTTTGCTATCTAAGGGTGCTTTCACACCTGCCTTATTCAGTTCGATTGAATCACACTAGAGTTCATTTCCCCTTTTGGTACGGTTCGTTTGGGCAGGTGAGAATGCAGCAATCGTACTCTAGTGCGCACCAAAAGCGGACCAAATAAGCGTACCGAGACCTGCTTGAAGAGGTGGTCTCGGTGTGCTTTCAAACGAACCCTGGAGCGGTTCGTTTGTGGTGAGAATATGATCCGTACTAAAACGGTCGAACCGCAAAAAGTACTGCGCCTTTTAGACCAATTCAGCTGCCGTAGGCCGATGCGCTGTGCATTATGGGATATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114610 None None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
ENSDART00000114610 None None 331 None 7
ENSDART00000114694 Nonsense 84 324 3 9
ENSDART00000121440 Nonsense 547 759 12 21
Genomic Location (Zv9):
Chromosome 25 (position 3563624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3539356
GRCz11 25 3664925
KASP Assay ID:
554-6222.1 (used for ordering genotyping assays)
KASP Sequence:
TGGARMTGCGCAGGAAACAGGAAGAGGCGGYRAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCWGCAATAAAARGTGYTATTTGGACCTGGTGTTA
Long Flanking Sequence:
GACATTACAAAGGCAAATAAATTTTTTTAAATTTATTTTTATTTTACTCATAGTATTTTTTTAAACGCATGACATTACAAATGGCAAATTCGATTTATTTATTTTAACCCATATGACCTGTTCTTTAAGTGTGAATGCAAAAGTATACTCAAAAGTCGATTGTGAATTTTAGGAAACGGGACGAGCGTTTGAAACGGGTTGTAGAGGCTCGAGTGAAAAGCGAAAAGGAGAAGGAGCAGGAAAAGAAAAAGAAGATCGAAGAAAAGATGGCACAGCTGGAGAAGAAAAACGACCTGGTCAGTGCTGAAGATCTTTAGACTCAATGTAGACCCATGCACTCCACTTGATTTGGATTCTTCATAAAGCTCTTGTTTTTCTCTAAGCTGCGAGTGGAGCGGATGGCGGAGGAGAAAGCCAAGAGGAAGGTGGCCACTAAACGACAGGAAGAACTGGAGCTGCGCAGGAAACAGGAAGAGGCGGCGAGACAAAAGAAACAGCAG[C/T]AAGTTGTAAGTCAATCCTGCAATAAAAGGTGCTATTTGGACCTGGTGTTAACATGCGTTCAGATTCATGGTTCTGTTTGGTGTAATGCACGAGGACTGAATGAATTGCGTACGTGATCTAAAACAAGTGAATTTGAAGAAAGTAAATATGGAAAATCTTGACATTGCGATATTTTGTTTTGCTATCTAAGGGTGCTTTCACACCTGCCTTATTCAGTTCGATTGAATCACACTAGAGTTCATTTCCCCTTTTGGTACGGTTCGTTTGGGCAGGTGAGAATGCAGCAATCGTACTCTAGTGCGCACCAAAAGCGGACCAAATAAGCGTACCGAGACCTGCTTGAAGAGGTGGTCTCGGTGTGCTTTCAAACGAACCCTGGAGCGGTTCGTTTGTGGTGAGAATATGATCCGTACTAAAACGGTCGAACCGCAAAAAGTACTGCGCCTTTTAGACCAATTCAGCTGCCGTAGGCCGATGCGCTGTGCATTATGGGATATAGA
Associated Phenotype:
Not determined