Busch Lab

ZMP

SGIP1

Ensembl ID:
ENSDARG00000077269
Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 [Source:HGNC Symbol;Acc:25412]
Human Orthologue:
SGIP1
Human Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 [Source:HGNC Symbol;Acc:25412]
Mouse Orthologue:
Sgip1
Mouse Description:
SH3-domain GRB2-like (endophilin) interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920344]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13141 Essential Splice Site Available for shipment Available now
sa39788 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13141
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Essential Splice Site 131 641 6 23
Genomic Location (Zv9):
Chromosome 2 (position 14423727)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14721771
GRCz11 2 14390361
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAATCACACTCAATTACTGAGATGATTTCCTCTGCTCTTTTCTTTTCA[C/T]ACACAGAGAAAGAGTCCGGTAAGCAAATGCATKCACACTTTAAAGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Essential Splice Site 446 641 18 23
Genomic Location (Zv9):
Chromosome 2 (position 14364999)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14663043
GRCz11 2 14331633
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTACAGCCGGCTGGAGCAGGTCCTTCCCAACCCGCAACTTCTGTGCTG[G/T]TAACATCTGCATTAGTGATGTCTAATTAGCGAACAAATGGTTAATTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31264
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Nonsense 466 641 19 23
Genomic Location (Zv9):
Chromosome 2 (position 14332351)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14630395
GRCz11 2 14298985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCACCTACAGGTGACATGAAGGAGTTCTGGGTGAATATGCCAAACTTGT[T/A]AAGCCACCTGAAGAAAGTGGCTGAGCAGAGGCCACAGGCCACATATTACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5128
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110723 Nonsense 490 641 19 23
Genomic Location (Zv9):
Chromosome 2 (position 14332280)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 14630324
GRCz11 2 14298914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAGCAGAGGCCACAGGCCAYATATTACAATGTAGACATGCTGAAGTAC[C/T]AGGTGAGTAATAATTTAATTCACAATCTGATTGTCTTGTAAGATTTGTTT
Associated Phenotype:
Not determined