Busch Lab

ZMP

vwf

Ensembl ID:
ENSDARG00000077231
ZFIN ID:
ZDB-GENE-070103-1
Human Orthologue:
VWF
Human Description:
von Willebrand factor [Source:HGNC Symbol;Acc:12726]
Mouse Orthologue:
Vwf
Mouse Description:
Von Willebrand factor homolog Gene [Source:MGI Symbol;Acc:MGI:98941]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa10088 Nonsense Available for shipment Available now
sa10698 Nonsense Available for shipment Available now
sa270 Nonsense F2 line generated Not yet available
sa36563 Nonsense Mutation detected in F1 DNA Not yet available
sa43038 Nonsense Mutation detected in F1 DNA Not yet available
sa36564 Nonsense Mutation detected in F1 DNA Not yet available
sa39187 Nonsense Mutation detected in F1 DNA Not yet available
sa32187 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10088
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 468 2812 11 51
ENSDART00000134872 Nonsense 454 2059 10 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6250602)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7205703
GRCz11 18 7164665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAACAYGGGGGAGTGGTCTCTGTTGATGGAATGGATGTGCAAACACCCT[T/A]AATTAATGGTTTGTCAASATGYAATAATGCATACATAATTCACACTGCTG
Long Flanking Sequence:
ATTTATTAGGCTCTTCACGTTTGAGTTGAGATTACGTTAAACTTTGAATTGAAAATTGACATTTCTAACAACTTCATGGGAACTTTGGGGGGGGGGGGGGAGTAATATTTTAAATAAAAAATTCTGATTCATTTTGTCCTCTTTCTATCTATAGGTGAGTGTTTGGTGACAGGACAGTCGCATTATAAGACCTTTGACAACAAATTCTTCACCTTCAGTGGGATTTGTCACTATCTGCTTGCTAAAGACTGCCAGAGCAACTCTTTTTCTGCCGTCATTGAGACTGCACAGGTCAGTTTCTTTCATCACACTGTCGTATTTGTTTTTTGGTAGTTTGGTTGTGCTTATGTTTGTGCATCCCTGTACAAAGTGTGCTGATGATCAAGATGCCATCTGCACACGCTCAATAACACTGAGGTTCAAGGATCTGGCCAATCAGACGGTTCACCTTAAACATGGGGGAGTGGTCTCTGTTGATGGAATGGATGTGCAAACACCCT[T/A]AATTAATGGTTTGTCAACATGCAATAATGCATACATAATTCACACTGCTGAATTATTTAGATGTTATGTAATGAGAATAAGTGTTTGTGTGTTTGTAGGTCCCCTGAGAATCCAGAATACCGTGTTGTCATCTGTGAGACTGCGTTATGGACATGATTTACATCTGGATTGGGACGGCAGAGGACGTGTTTTGCTCAGGGTAAATGTGGCCTGTTAAAAAAACAGGCTTTGGAAGCTTAACTCGGTCAAGTTTAAGGGGTTAGTTCACCAAGAAATGAAAATGACCTCATTATTTAATCTCCATTGTGTAGTTTTTAAAACCTTTTTCTGGTCTCTTTCTGCTGTTAAGCACAAAATAAGATATTTTGAAGAATGCTGGTTTCTGGCACCCACTGACCTTCATTGTAGGACACAAAATATTTTGTAAGCCAGCAACCAGCAACATTCTTCATAATGTGTTTAACAGAAGAAAGAAACTCAAATAGGTTTCGAATAAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 597 2812 14 51
ENSDART00000134872 Nonsense 583 2059 13 34
ENSDART00000142905 None None 444 None 11
ENSDART00000114690 Nonsense 597 2812 14 51
ENSDART00000134872 Nonsense 583 2059 13 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6253836)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7208937
GRCz11 18 7167899
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTCCATGAAGTTCGAACCCTGTCATKATATGGTGAACCCTGAGCCGTA[T/A]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTG
Long Flanking Sequence:
ACCATTTTAAGGTCAAAAATATTAGCCCCCTTAAGCAATTTCTTTTTTGATTGTTTACAGAACATCTATCATACAATAACTTGCCTAATTACCCTAACTTGCCTAGCTAACCTACTTTAATTAACCTTGTTATGTCTTTATTCTCAATACTAGAATCTTGAAAAATATCTAGTGAAATATTATTCACTGTCATCATGGCAAAGATAAAAGAAATTATTAAAACTATAATGTTAAGCATTAAGATTAAACAGTTAATGTTAAACAGAAATTAAGTTAAAAAAAATTCAGGAGGGCTAATAATTCTGACTTTAACTGTATGTGTATATAATGCAATGTACTGTTTACATATGCACTAAACACTAGAGGGCAACAAAGACCAGCAGGAAAGATTTTAATGTTTTGGTATGTGTGTCTGCAGTGCGTTTTGCAGAAGAGGCCTGTGCTGTGCTGCTCTCCATGAAGTTCGAACCCTGTCATTATATGGTGAACCCTGAGCCGTA[T/A]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTGTCTGTGTGACGCTGTGAGCAGTTATGCAGTCGCGTGCGCAGCCAGAGGAGTGCTGGTCAACTGGAGGAGTCACGGATACTGTGGTATATATGCTGTATATACTGTAAATATAGAGATTTGGGGTTCATAACTAATAACTGTATTTCGAGTCAGATATGTAAAAAACATCCAAACAAATACTTTAATTTTGTCTTATCACACTTTATTTAATAAAGGTAACGTTACTGTATGTCGCAGTTCCTCCAAGATTTAGCTATAAATTATTATTTGTTTGCTGTGGCTTTTCTTATAATCTGTGGTAATATTCAGGCCATTCGTGTAATTTTGCTGTGGAAATGTACGCAAATTTGTACTTCTTTTTTCTTTACGTTTCAACCAATGATCTCTGTAACTGACGTAAAGGAAACGCGGAGAGAAACAAACTTGAGTGTTTACCTTTTAACATATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa270
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 597 2812 14 51
ENSDART00000134872 Nonsense 583 2059 13 34
ENSDART00000142905 None None 444 None 11
ENSDART00000114690 Nonsense 597 2812 14 51
ENSDART00000134872 Nonsense 583 2059 13 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6253836)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7208937
GRCz11 18 7167899
KASP Assay ID:
554-2783.1 (used for ordering genotyping assays)
KASP Sequence:
CTCTCCATGAAGTTCGAACCCTGTCATKATATGGTGAACCCTGAGCCGTA[T/G]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTG
Long Flanking Sequence:
ACCATTTTAAGGTCAAAAATATTAGCCCCCTTAAGCAATTTCTTTTTTGATTGTTTACAGAACATCTATCATACAATAACTTGCCTAATTACCCTAACTTGCCTAGCTAACCTACTTTAATTAACCTTGTTATGTCTTTATTCTCAATACTAGAATCTTGAAAAATATCTAGTGAAATATTATTCACTGTCATCATGGCAAAGATAAAAGAAATTATTAAAACTATAATGTTAAGCATTAAGATTAAACAGTTAATGTTAAACAGAAATTAAGTTAAAAAAAATTCAGGAGGGCTAATAATTCTGACTTTAACTGTATGTGTATATAATGCAATGTACTGTTTACATATGCACTAAACACTAGAGGGCAACAAAGACCAGCAGGAAAGATTTTAATGTTTTGGTATGTGTGTCTGCAGTGCGTTTTGCAGAAGAGGCCTGTGCTGTGCTGCTCTCCATGAAGTTCGAACCCTGTCATTATATGGTGAACCCTGAGCCGTA[T/G]GTGAAGAACTGCCGCTATGATGTGTGCGCATGCGCAGATGGTCAGGAGTGTCTGTGTGACGCTGTGAGCAGTTATGCAGTCGCGTGCGCAGCCAGAGGAGTGCTGGTCAACTGGAGGAGTCACGGATACTGTGGTATATATGCTGTATATACTGTAAATATAGAGATTTGGGGTTCATAACTAATAACTGTATTTCGAGTCAGATATGTAAAAAACATCCAAACAAATACTTTAATTTTGTCTTATCACACTTTATTTAATAAAGGTAACGTTACTGTATGTCGCAGTTCCTCCAAGATTTAGCTATAAATTATTATTTGTTTGCTGTGGCTTTTCTTATAATCTGTGGTAATATTCAGGCCATTCGTGTAATTTTGCTGTGGAAATGTACGCAAATTTGTACTTCTTTTTTCTTTACGTTTCAACCAATGATCTCTGTAACTGACGTAAAGGAAACGCGGAGAGAAACAAACTTGAGTGTTTACCTTTTAACATATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4739
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Essential Splice Site 840 2812 19 51
ENSDART00000134872 Essential Splice Site 826 2059 18 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6261445)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7216546
GRCz11 18 7175508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGCTGTATCGAGAGATGTAAATCCTCACTCGATCTCCCTGTGTGTTTCA[G/A]TGTGTGTGAGCAGCGTCAGTGGAAATGTTCAGAGCGAGTGTGTGACGGTG
Long Flanking Sequence:
ATGCCCTTCCAGCCACAACTCAGTACTCATAGACTCTCCCATTCACACACACTCATACACTACTGCAAATTATTCATTTCACTTATAGCACATGTGTTTGGACTGTGGGGGAAACCGGAGAACATGCAAACTCCACACAGAAATACCAACTGACTCAGTCGAGGCTCAAACCAGCAACCTTCTTGCTGTGAGCCGACTAACCACTGAGCCACCGTGCTGCCAAACAAACACATAGAAAGATGAAAAGACTAAAAAGACACTCAGTACTAATATGAATTGAAACCACAAAACACAGTTAATGGCTGATTAAAAGCAAGTGATAATAAATGACTGAAGAATTGAAATGGTCTTACATGATCTTAGAGAGCTTTTTACTGTATCTGCATTTTCACAATTTATATGCATCTTGGTCTTTCCACTAAGCAATTGTGTATGTGCATAACAAAAACTTAGCTGTATCGAGAGATGTAAATCCTCACTCGATCTCCCTGTGTGTTTCA[G/A]TGTGTGTGAGCAGCGTCAGTGGAAATGTTCAGAGCGAGTGTGTGACGGTGTGTGTCGTGCTATTGGAGACACACACTACATCAGCTTTGACGGACTCAAATTCTCCTTCCCTGGACCCTGTCAGTATGTGCTCGCTCAGGTAAAGCCAATATTCTCCTCTCATATTCACAAAGGGCGTGACAAAAATAATCAATATGCAGATTTCTTGCCATATTTGTGGGTGTGAGGTGTTATCGATATTATGGCTTTGATATTTTTAGGCATACCGCTCCACTACATTGCAAGTAAATCACTTAAGTTAGTAAAGTTAGTAAATCACTCAAGCCTGTTCATCCACATGTCCATCTGTCTCTATCTCTATCTGTCAATCTATCCATCCAATTATGTTTCTTTCTGTCACTCCATCTCTCCATTCATCTATGTCCACCTCTCGATCTGTCCATCAATCCATCCATGCCTCTGTCTGTCCATTCGTCCATATGTTTATCTATCTATCTATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4740
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 968 2812 21 51
ENSDART00000134872 Nonsense 954 2059 20 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6264048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7219149
GRCz11 18 7178111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTATTATATTGTTCTGCTCGGCAAACACATCTCAATTACATGGGACACG[G/T]GAACCCGAATCTCCCTGCAGATCAGCGGACAGTACAGGGTAACACACATT
Long Flanking Sequence:
AAATTAGCTTAAAGGGGCTAATAATTTTGACCTTAATTTCACCTTAAAATGGTGTTTAAAAAATTAAAAACTGCTTTTATTCTAGCCAAAATAAACTAAATAAGACTTTTTCCAGAAGAAAAAATATTAACAGACATAATGTGAGAATTTCCTTGCATATATATTTATAATTTATTTTTATTAAACTTTTATTCTTCATCATTACAAAAAAAAAGGATTAAAGAAAGAGATTTAATTAAAGGTATAATTCACACAAAAATCAAAAATTCCAAGCCAATTTTGGTCTACAAAATATTTGGGTATTATCGTATATGAACTACTCTTCCATGACCAAGAACGAATATGACTTACTTTATGAGAAGCAATAGAGTGTGTGTGCTGTTCTCCGTCAGGTGAGGATGAAGAGGCCTGTGCTGAAGGAGACGGAGGTTGAGATTGTGAGATCTGGACTGTATTATATTGTTCTGCTCGGCAAACACATCTCAATTACATGGGACACG[G/T]GAACCCGAATCTCCCTGCAGATCAGCGGACAGTACAGGGTAACACACATTCATACACATGTATCAAATTAACTAAAGAAAAACATATAATATATTTCATCCTACATCTCTACATCATCTAAATCTTAGATTTAGAAAGTGTGTTGTGTGTTTGAATAAATATAATTCACGCTTTTAATTTTTTTATGTTTATATTCATAATAAGTAGTAATAAATAGTATAACAACATAAATATTTGATAACGTACATAAGTGAAAAATATAATAATGCAAACAAGTGAATTTTATAAAACAGCATAAAATTTACTTATTTTATTTTTACAATGTTAGATTTACATGCAGATTTAAGTAAAGTAGAAAAAGCCCACACTAGGACAACTTATTTGTTAAATTAAAGGGATAATTCACCCAAAATTACTCCCTCTCGAGTGGTTCTAAACTTGAAAATTAATTTCTTTCTTTTGTTCAACATAAAACAAGATACAATAAAGGATGCTGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 977 2812 21 51
ENSDART00000134872 Nonsense 963 2059 20 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6264075)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7219176
GRCz11 18 7178138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATCTCAATTACATGGGACACGGGAACCCGAATCTCCCTGCAGATCAGC[G/T]GACAGTACAGGGTAACACACATTCATACACATGTATCAAATTAACTAAAG
Long Flanking Sequence:
TGACCTTAATTTCACCTTAAAATGGTGTTTAAAAAATTAAAAACTGCTTTTATTCTAGCCAAAATAAACTAAATAAGACTTTTTCCAGAAGAAAAAATATTAACAGACATAATGTGAGAATTTCCTTGCATATATATTTATAATTTATTTTTATTAAACTTTTATTCTTCATCATTACAAAAAAAAAGGATTAAAGAAAGAGATTTAATTAAAGGTATAATTCACACAAAAATCAAAAATTCCAAGCCAATTTTGGTCTACAAAATATTTGGGTATTATCGTATATGAACTACTCTTCCATGACCAAGAACGAATATGACTTACTTTATGAGAAGCAATAGAGTGTGTGTGCTGTTCTCCGTCAGGTGAGGATGAAGAGGCCTGTGCTGAAGGAGACGGAGGTTGAGATTGTGAGATCTGGACTGTATTATATTGTTCTGCTCGGCAAACACATCTCAATTACATGGGACACGGGAACCCGAATCTCCCTGCAGATCAGC[G/T]GACAGTACAGGGTAACACACATTCATACACATGTATCAAATTAACTAAAGAAAAACATATAATATATTTCATCCTACATCTCTACATCATCTAAATCTTAGATTTAGAAAGTGTGTTGTGTGTTTGAATAAATATAATTCACGCTTTTAATTTTTTTATGTTTATATTCATAATAAGTAGTAATAAATAGTATAACAACATAAATATTTGATAACGTACATAAGTGAAAAATATAATAATGCAAACAAGTGAATTTTATAAAACAGCATAAAATTTACTTATTTTATTTTTACAATGTTAGATTTACATGCAGATTTAAGTAAAGTAGAAAAAGCCCACACTAGGACAACTTATTTGTTAAATTAAAGGGATAATTCACCCAAAATTACTCCCTCTCGAGTGGTTCTAAACTTGAAAATTAATTTCTTTCTTTTGTTCAACATAAAACAAGATACAATAAAGGATGCTGGGAAAAGCAGCCATTGACATCCATAGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 1308 2812 27 51
ENSDART00000134872 Nonsense 1294 2059 26 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6269799)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7224900
GRCz11 18 7183862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCACACTCGCGCCACAGTCCTCCTCTTCCACTCTGGGGTGAAAAGTTA[C/A]GACATGCAAGTGCAGAAGTGGATCTTCAAGAAGATGGTGCGCGAGATGCG
Long Flanking Sequence:
ATAGAAGGTCATTTTTAAAAACCCATAATAGGGGCTCTTTAATGATTCATGCGTTAACATAAACATTAAACAACTGCATTTTCGTCAACTAATGTTATCTAACACGAATAAATACTGTAGTAAATGTATTGATTATGTTAGTAAATACATTAACTCATACAACCTTATTGTAAAGTGTTAACAATGTGTGTTTGTGTTGTTTTCAGCCACTGTGAGAGCAACACACTAACATGTGGGCCATGTCCAGTAACTGGTTTAACCTCCACACTGGCACCAACCACCGTCACTCCCACTCCACTGCCGTTCTCCACCCCGGTGCCTGCGGATGCCTGCGATCGAGCCATGGACCTGGCCTTCCTGGTGGACGGATCTTCAGCTCTGAGCGAAGACGACTTCAGCATGATCAAACTCTTCATCCTCAGAGTGGTGGAGCGTTTCCGCATGGGCTCGGCTCACACTCGCGCCACAGTCCTCCTCTTCCACTCTGGGGTGAAAAGTTA[C/A]GACATGCAAGTGCAGAAGTGGATCTTCAAGAAGATGGTGCGCGAGATGCGGTACACCGGTGGTGATGTCGCATTCATGGATGAAGCCATAAAATATCTTGCAGTCTACATTTATGATAAAAACAAGCGTGAGCATGCGGGACGTGTTGCGATTCTGTTGACGGCAAGTGCTAATCCTCGGCCCATGCGCAGTACTCAACGTCTGCTGCGTAAGAAGGACATCACCATCCTCACAGTGGCACTCGGGCCTGATGTTAACATGGCGCAGGTCAACGAGATCACGAAAGCCACACCGAGCAGTCGTGCCTACGTAGTGAGCAGCGTAACAGAGCTGGACGATGAAGCTTTGAGCATTACTGACTACCTTTGTACTTTGGGATTAGATCCTGAACCTCAGAAGAAACCTCCTACAGCAAAACCCAGCACTACTTCAGTTACTCCAACAACTAACGCCATTACTAAACTTACTATTCCTCCAACCGCTGCTATTGTAACTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36564
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 1632 2812 27 51
ENSDART00000134872 Nonsense 1618 2059 26 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6270769)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7225870
GRCz11 18 7184832
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGAGCTCCACTCATAAGAAGATCTATCCGATCGGGATCGGCCGAAAAATT[C/T]GATATGAGGATCTCGCACTGTTGAGCTTTCCGGATAAGCCAATCATGCTG
Long Flanking Sequence:
TTCCTCCAACCGCTGCTATTGTAACTGCATTTCCCAGCATTCCCACTCCTGGAACGACACTCGTTCCAACCACGGTCACAACCTACGATCTTGTGTTCCTCTTGGAAAACGCAAACGCTACAGGCGAGGACGGCTTCAATAAGACGCGTGATTCTTTGATTAACATCATCACATCACTTGATCAGAAAGAGGCAGAGAATCTACGCATTACGGTGATGATGTACTCGGTCACCGTTACTGTGGAAATCAGTCGCATGGAGCTGCATCACAGAGAACAGGTGGTGCAGCGAATGCGACAGTTGCGTTGGACCGAAGGCGCAGAGGTCAACACAGGTCACGCCGTTCAGTCTGTATACGAGACGATCACCACAGACACACACAGTGATACTCCAGACCAGCTGGTGTTTCTCATAACACAGAGTCCTCCAACTGACGTCATTCAGCGGCCTCCGAGCTCCACTCATAAGAAGATCTATCCGATCGGGATCGGCCGAAAAATT[C/T]GATATGAGGATCTCGCACTGTTGAGCTTTCCGGATAAGCCAATCATGCTGGATGACCCTTCTGACCTCAGGACACTGCAGCCCATGTTGATCAATATCAGTAGGACGGTCAGAAGGCCACTGCTGCCAACACTGCCACCCAGAGCCACACTGCCCCCTTCAGGTCAGAATCAACACTACAGTCTTCACTTTTAACTACCATCACATAATTGATTTGTGGAACAACATGAAAATTAAGTTAACTATACAAGTGGATTGAACATAAAACAATTAAGTTGTCCCAGAAAGAACTGAATTGTGTCATTTTGGCTAATTTTAAATAAGTAGCTTGAACAAGCAGCAAACGTCATTTTTTTGTACGTTTTAAAACGTACCACCCAATTGACAGCTTTTGTACATTTACTTCTGAGAGTGTACTATGCTCTTTCTTATAAATTGATTTTATTGTTATCATTCCACTGCACACACTGTGTTTTTCATTTCAGATATTCTCAGATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39187
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Nonsense 1855 2812 31 51
ENSDART00000134872 Nonsense 1841 2059 30 34
ENSDART00000142905 None None 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6274313)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7229414
GRCz11 18 7188376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTCGCAGGCCCACAGGCTCAGGAAAACGTCATTCTGCTCGGCAGCACA[G/T]AGTATCTGCTTTCCATGGCTGCGTTTGACCAGTCCTTCCCTGACAAACTC
Long Flanking Sequence:
TCAACCTGGCAACCACTCAATACCTCTTTTAGTAATGGCTAGGCCCAAATGCACATGTAGAAATCTGCTGATTTTTAGCCCATCGTTGATTTAAATGTCACTTTAAGTTGTATAGAAATTTCTTGAAAAATATCTAGTCAAATATTATGTACTGTCATCATGGCAGATGATGATAAAATAAATCAGTTATTAGAGATGAGTTATTAAAACTATTATGCTTAATGTGTTGAAAAAATTTTCTTTCCAGAAATTGGAGAAATAAGGTTTTGTAGTCCAGGGTCACGTATTATAAATATCTGTCTCTTTAATGAATTGCTTTTGTATTTCTTATGCTCGTCTGCTGACTGCATCAATGTAAACCTAATACTCACAACACATGTTTGTTGCGCACAGGTGTGTCGGTGTTTCCTATTGGTCTGGGTAAGCAGTATGATCAGATTGAAGTGAACACACTCGCAGGCCCACAGGCTCAGGAAAACGTCATTCTGCTCGGCAGCACA[G/T]AGTATCTGCTTTCCATGGCTGCGTTTGACCAGTCCTTCCCTGACAAACTCTGCAGAGGTCAGACTCAAGCATACACATAAACACAATCAAACACACTACTGTACAAATGTAGTAATAATAATGATGATCAAATTATCCCTCAGCGGGTCCTCCCGGAGTGTGTGTGGATGATGAAGGGAATGAAAGAAAGGTAAACTGTGTTTTAGTAGGACATGCATGGAGTCAACCTAGGGCCATATATACTTGCAAAATAAAAGAAAGTTTGGAGCAAAAAAAATTATTAATAAATAAATGCAAATATCTAAAAAAAAATCACAAAGCAAAAATTAATTTTAGAGAAATACAAATTAATTTTGTTAACAAAAATAAAGAACTGCAAAGCAGAAACTAATTTTTGAGAAATTTAAATTTATTTTGCTAACAAAAAATAAGGAACTGCAAAGCAAAAATTAATTTTTGAGAAATTAAAATTAATTTTGCAAACAAAAATAAAGAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32187
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114690 Essential Splice Site 2488 2812 None 51
ENSDART00000134872 None None 2059 None 34
ENSDART00000142905 Essential Splice Site 272 444 None 11

The following transcripts of ENSDARG00000077231 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 6299435)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7254536
GRCz11 18 7213498
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACATCGCTCAGTGTGTGGACCCCGTCTGCAACCAGATCTGCCCTGTGG[T/C]GCGTCCTACACAACTCCGCCTCAGTCTGTGAGATTGAGTCATATTCACTT
Long Flanking Sequence:
GTCTCTTCCCCTGCCCTTTCTCAGTGTGCAAAAAGGATCAGTGTCCTGACTCAACAAAACCTTCCTGTCCTGCATACAAGAAGCTGTCGGTGAAAGCATCCGAGTGCTGCGATTCATACCAATGTCTGTGCAATTGTCAAAACATCACCCGCACCTGCCCTCCAGGCTACATCACAAAGACCAGCACCAATGATTGCCAATGCACAGAGGTCACCTGCACGCCTGATAAGGTTGGCACGCTTTAAAAGTCTCGCTGAGTGTGTGTATGTGTGTGTGTTATTGACTTGCCCTTGCAGCGCTGTGTTTTGGACTCTGAGATCAGCATGTGACGGGTTATTTATGTGTGCAGGTGTGTGTGGTGGACGCTGTGGTGTACCAGGTGGGCAGCAGGTGGGAGGAGAAGTGTAAAACTTGCAGATGCACCGAGCAGACGGACGGACAGACCGGCCTGCACATCGCTCAGTGTGTGGACCCCGTCTGCAACCAGATCTGCCCTGTGG[T/C]GCGTCCTACACAACTCCGCCTCAGTCTGTGAGATTGAGTCATATTCACTTGGGAAGTTTTAAATTTTTTTATTTATAGAAGTTTTTACAACCCCAAATCAGAAAAAAATTGGGACCGTTTGGAAAGTGTAAATAAATAAAAAAATGTGATTTCCAAATTGACTTATTTGACAATTGACTTGACAAAATACAAAATATTTAATAATAATAATAATAATATTAATAATAATAATAATAATAATAATAATAATAATAATAGAGCATTTTAAAGCTCTATGTATTTATTTTTTAATGAAATTTTACAGATCTAATTAACTTTCAGATAATTGTTTAGAAAAACAATATATTTCTTTATATATAATATCTCTCCTACAATATATGTCTAGACTACAAAAATGTCATTAAAAATCACTTTGTTAAACAATATGGTTAAATTTCCTATTAAAATACAATTCATAATATAAACAGAAAACACCCTTGAGTCATGAGCTAAAGACAACA
Associated Phenotype:
Not determined