Busch Lab

ZMP

si:dkey-220o5.5

Ensembl ID:
ENSDARG00000077212
ZFIN ID:
ZDB-GENE-081104-376
Description:
Novel protein with a PH domain [Source:UniProtKB/TrEMBL;Acc:B8JJ20]
Human Orthologue:
AFAP1L2
Human Description:
actin filament associated protein 1-like 2 [Source:HGNC Symbol;Acc:25901]
Mouse Orthologue:
Afap1l2
Mouse Description:
actin filament associated protein 1-like 2 Gene [Source:MGI Symbol;Acc:MGI:2147658]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34481 Nonsense Mutation detected in F1 DNA Not yet available
sa34480 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34481
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109253 Nonsense 117 429 4 10
ENSDART00000141982 Nonsense 35 286 1 6
Genomic Location (Zv9):
Chromosome 8 (position 46991597)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44555486
GRCz11 8 44549392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGGACAGAGCTCATTATGTCCATTGGAGGTTTTCTCAACCCACCATA[C/T]GACCCGATTCAGAGTCACGCATCTGTGGATATCTTTGGAGGAAGAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34480
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109253 Nonsense 314 429 8 10
ENSDART00000141982 Nonsense 232 286 5 6
Genomic Location (Zv9):
Chromosome 8 (position 46985106)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44561977
GRCz11 8 44555883
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTATCGTGATGAGGCTTCTTTAGAAATCCCTGAGTACACAGTTCACCTC[A/T]GAGGGAGTGATGTTCGACCTGGCCCTGATACAGAACATGCTTACCGCATT
Associated Phenotype:
Not determined