Busch Lab

ZMP

slc15a1a

Ensembl ID:
ENSDARG00000077192
ZFIN ID:
ZDB-GENE-091204-9
Human Orthologue:
SLC15A1
Human Description:
solute carrier family 15 (oligopeptide transporter), member 1 [Source:HGNC Symbol;Acc:10920]
Mouse Orthologue:
Slc15a1
Mouse Description:
solute carrier family 15 (oligopeptide transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:186137

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa1756 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3715
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090215 Nonsense 297 717 11 23
ENSDART00000133112 Nonsense 314 734 11 23
Genomic Location (Zv9):
Chromosome 9 (position 1026114)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 993605
GRCz11 9 1151237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACTCCTCATTGCGCAGATAAAGATGGTGCTGAAGGTGTTGTTCCTCTA[C/A]ATCCCCCTGCCCATGTTTTGGACCCTGTTTGACCAGAAGGTAAAYTATTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1756
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090215 Nonsense 714 717 23 23
ENSDART00000133112 Nonsense 731 734 23 23
Genomic Location (Zv9):
Chromosome 9 (position 1035338)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 1002829
GRCz11 9 1160461
KASP Assay ID:
554-1749.1 (used for ordering genotyping assays)
KASP Sequence:
AGAAGGAGACWCTAGAAATGGAGGAAAAGGAGAACGAGCAGRAAATCAAA[C/T]AAACCAAGATTTAAGACTTGAAGATTGAGTTRCGCTCATGCTAATATCTT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461