Busch Lab

ZMP

NP_957234.1

Ensembl ID:
ENSDARG00000077180
Description:
solute carrier family 37 (glucose-6-phosphate transporter), member 4b [Source:RefSeq peptide;Acc:NP
Mouse Orthologue:
Slc37a4
Mouse Description:
solute carrier family 37 (glucose-6-phosphate transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa34967 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3756
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111362 Nonsense 163 453 4 10
Genomic Location (Zv9):
Chromosome 10 (position 40484990)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39200661
GRCz11 10 39143941
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CWGGCAGGTAGTCTGGGCCCCATCATCACTACAGTGCTGGTCCAGTATTA[T/A]GACTGGAGGGTCATCATGTCCGTGTCTGGGCTGATCTGCATGGCCGTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34967
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111362 Nonsense 234 453 5 10
Genomic Location (Zv9):
Chromosome 10 (position 40481747)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 39197418
GRCz11 10 39140698
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGTCTAAAGGATTTCCTGCTGTCTCCTTACCTGTGGGTTCTGTCTGCC[G/T]GATACCTGGTTGTGTTTGGGGTAAAGATCGCCTGCACTGACTGGGGTCAG
Associated Phenotype:
Not determined