Busch Lab

ZMP

LOC559603

Ensembl ID:
ENSDARG00000077174
Human Orthologue:
QSOX2
Human Description:
quiescin Q6 sulfhydryl oxidase 2 [Source:HGNC Symbol;Acc:30249]
Mouse Orthologue:
Qsox2
Mouse Description:
quiescin Q6 sulfhydryl oxidase 2 Gene [Source:MGI Symbol;Acc:MGI:2387194]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2207 Essential Splice Site Available for shipment Available now
sa15428 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2207
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Essential Splice Site 108 635 4 12
ENSDART00000127924 None 2 283 1 6
Genomic Location (Zv9):
Chromosome 5 (position 67856676)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63610406
GRCz11 5 64291605
KASP Assay ID:
554-2598.1 (used for ordering genotyping assays)
KASP Sequence:
TTGCTGTTATGGTGTGTAACTGACTTGGNTNTTTCTCATTTTGTGTACTGAT[A/C]GGAGCTGACAGAGAGCTTCAGACAGTCAGGCAGTTGATGGTGAACTTCAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15428
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Essential Splice Site 173 635 5 12
ENSDART00000127924 None None 283 None 6
Genomic Location (Zv9):
Chromosome 5 (position 67859617)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63613347
GRCz11 5 64294546
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACACTGCAGTTATAGTTGAGGACGGAAACTCCTACATAGGGAGAGAGG[T/A]ATGARAAATGGTTTWCCRCTTTTGAGGACAGGATRAAATCATYATTTACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26612
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Splice Site, Nonsense 223 635 7 12
ENSDART00000127924 Splice Site, Nonsense 39 283 2 6
Genomic Location (Zv9):
Chromosome 5 (position 67864322)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63618017
GRCz11 5 64299216
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATAGATGAATTGTTTATTTTATGTGTTTTTTTATTTTGTTGTTCACAGG[C/T]AGAAGAAGTTACGTTTTTTCTTCTCCTCCTTCCTAAAACTTCTCCCTGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26613
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111282 Essential Splice Site 270 635 7 12
ENSDART00000127924 Essential Splice Site 86 283 2 6
Genomic Location (Zv9):
Chromosome 5 (position 67864466)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 63618161
GRCz11 5 64299360
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGGATTAATGGACAGGGAGCCCAGGTGGAGTGGAAAGAGTTTAAAAAG[T/A]GAGTTTTATTGATTTATATGCTACTGCTCAAAAGTCTGTACTCGGATAAT
Associated Phenotype:
Not determined