Busch Lab

ZMP

si:dkey-46g23.2

Ensembl ID:
ENSDARG00000077171
ZFIN ID:
ZDB-GENE-070705-476
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa33077 Nonsense Mutation detected in F1 DNA Not yet available
sa33076 Nonsense Mutation detected in F1 DNA Not yet available
sa33075 Nonsense Available for shipment Available now
sa19929 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33077
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 11 1458 1 34
ENSDART00000108732 Nonsense 11 401 1 11
Genomic Location (Zv9):
Chromosome 3 (position 3931456)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3616006
GRCz11 3 3398259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGGATGATTGCTCATCATGGCGATGATGGAGATCAGTGTTTGGAAGTG[G/A]ATCAATCTAGTCCTTTTCTTCTGTTTTGTTGATGGTGCCATGCTTGCTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25975
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 705 1458 16 34
ENSDART00000108732 None None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3926118)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3610668
GRCz11 3 3392921
KASP Assay ID:
2259-2946.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCCAGTTCGAGAGCCTGAGTGCCTTAAGTTCAAAGACCTGCTTTACTA[T/A]CGCAACTTCCATGGGGGTATGTCTGTTTGCTTAAAGTAACTTTATTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33076
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 893 1458 20 34
ENSDART00000108732 None None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3925146)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3609696
GRCz11 3 3391949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTAGGAACTGTAAACGTGACCATTAGTGCTGAGGCCAGTCCATCCCAG[G/T]AATTGTGTGGCGATCAGGATGTGACTGTACCATCAAGAGGACGCATTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33075
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Nonsense 931 1458 21 34
ENSDART00000108732 None None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3924947)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3609497
GRCz11 3 3391750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCCTCTAGGCTGAAGGAGTGGAAAGGACCTTCACACGGAGTTGGT[T/A]ACTCTGTCCAAAGGGTTTGTTCAACTTAAGAATTTTATTCTACATTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19929
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047865 Essential Splice Site 1048 1458 24 34
ENSDART00000108732 None None 401 None 11
Genomic Location (Zv9):
Chromosome 3 (position 3923702)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3608252
GRCz11 3 3390505
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGTGATGGTTCATTCAGCACTTTTGGCTATGATCCATCCAATACATG[G/A]TGCGTGTCCTGCAGGTCAAGTCTTATTGATTTAGGTGTTGTGTAACTGAA
Associated Phenotype:
Not determined