Busch Lab

ZMP

si:ch73-83c10.1

Ensembl ID:
ENSDARG00000077165
ZFIN ID:
ZDB-GENE-100922-16
Human Orthologue:
KCNJ3
Human Description:
potassium inwardly-rectifying channel, subfamily J, member 3 [Source:HGNC Symbol;Acc:6264]
Mouse Orthologue:
Kcnj3
Mouse Description:
potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI Symbol;Acc:MGI:104742]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15616 Nonsense Available for shipment Available now
sa21426 Nonsense Available for shipment Available now
sa45344 Nonsense Mutation detected in F1 DNA Not yet available
sa14208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 13 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4511320)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4538274
GRCz11 9 4506783
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGCARGRTAAGATGTCTGCACTCCGTAAGAAATTTGGAAATGACTAT[C/T]AGGTAGTGACCACTACCTCCTCCAGCCATCTGAAGGACAAGAGGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3720
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 30 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4511269)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4538223
GRCz11 9 4506732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTAGTGACCACTACCTCCTCCAGCCATCTGAAGGACAAGAGGAGGAAA[C/T]GACAACGATTTGTGGATAAGAACGGACGATGTAACGTCCARCACGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21426
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 39 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4511242)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4538196
GRCz11 9 4506705
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGAAGGACAAGAGGAGGAAACGACAACGATTTGTGGATAAGAACGGA[C/T]GATGTAACGTCCAGCACGGAAACTTGGGCGGAGAGACCAGCAGATATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45344
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 201 490 1 3
Genomic Location (Zv9):
Chromosome 9 (position 4510756)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4537710
GRCz11 9 4506219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAAATGCAGCCATTTCCATGCGTGACGGCAAACTCACGCTGATGTTC[A/T]GAGTGGGAAACCTGCGCAACAGCCACATGGTTTCAGCCCAAATCCGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14208
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113975 Nonsense 279 490 2 3
Genomic Location (Zv9):
Chromosome 9 (position 4505426)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4532380
GRCz11 9 4500889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACTAAGAGCCCCTTCTATGAACTTTCACAACACTCCATGCAGACWGAA[C/T]AGTTCGAAATTGTYGTGATTTTGGAGGGTATTGTTGAAACAACWGGTARG
Associated Phenotype:
Not determined