Busch Lab

ZMP

si:dkey-50p8.3

Ensembl ID:
ENSDARG00000077093
ZFIN ID:
ZDB-GENE-030131-9003
Human Orthologue:
SFRS15
Human Description:
splicing factor, arginine/serine-rich 15 [Source:HGNC Symbol;Acc:19304]
Mouse Orthologue:
Srsf15
Mouse Description:
serine/arginine-rich splicing factor 15 Gene [Source:MGI Symbol;Acc:MGI:2146350]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa21738 Nonsense Available for shipment Available now
sa34908 Nonsense Mutation detected in F1 DNA Not yet available
sa24872 Nonsense Mutation detected in F1 DNA Not yet available
sa736 Essential Splice Site, Missense Available for shipment Available now
sa41664 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa24871 Nonsense Mutation detected in F1 DNA Not yet available
sa13563 Nonsense Available for shipment Available now
sa38801 Nonsense Mutation detected in F1 DNA Not yet available
sa5829 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27616
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Essential Splice Site 108 1104 None 26
ENSDART00000125665 Essential Splice Site 108 1023 None 22
ENSDART00000140483 Essential Splice Site 94 1056 None 20
Genomic Location (Zv9):
Chromosome 10 (position 26346908)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25750765
GRCz11 10 25712478
KASP Assay ID:
2260-3284.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTCATTGTATGACTAATGATTTGAATATTCATGTGTTTTTTTTTTC[A/C]GAGTAAGATAGTACGAGTGCTCAACCTGTGGCAGAAGAATGGAGTGTTTA
Long Flanking Sequence:
TTCACATTGGATACTTAATATGGTTAGTTAGAATATGATTTAAATCTGTTTACTTGTCACCCATGAGGCTTGTAGTCAAAGATACTTGAACGCAGTGACATTTGAAAACATTTTGTCTTTCAGTTATACAAGCATGTTGTCCAGATAGTGGAAAAGTTCATAAAGAAGGTAGGTGCCTGTCGGAACTTGATTAAAGTTGAATGATTGTTGGCTGTATTTAGTTACTGAATGTTATTCCGTGCACAGTGCAAACCGGAGTACAAAGTTCCCGGTCTCTATGTGGTGGATTCCATTGTGAGACAGTCACGGCATCAGTTTGGAGCAGATAAAGATGTGTTTGGACCCAGGTTTACTAAAAACATCACTGGGACATTTGAGAATCTATGCTTGTGTCCCACTGAAGATCGGGTGAGAGTATTTAAATATAAAGACTATAAAAGATTTATTTAGTTGTGTCATTGTATGACTAATGATTTGAATATTCATGTGTTTTTTTTTTC[A/C]GAGTAAGATAGTACGAGTGCTCAACCTGTGGCAGAAGAATGGAGTGTTTAAGATCGAGGTCATTCAGCCTCTGTTGGACATGGCTGCTGGGTCCAGCAGCTCCTCAGGCTTGGACAATGGCCCAGATGCAGGTAAGATACAGTTTTCTTTCATTTGAGATTGGTAATACAATCTACTATCATTTTTTTGTGCGAGAAATGTGAAAATATGTCTTACATTTATGAAAAATGTGTTTTTTGCAAATAATTTATCAAGGAAACTTTAAATTGACTAAAAGCAACTTTAGAAACATTGCTAAAGTAGAAAAATATAATACAATTCTAGTATTGTATTTTGTAATATAGCCCAGTATGTTGTTCAAATGAATGCTGCCTTGAGTATGAAATGCTTTTTAAAACATTTAAATAGTTATTGACCTAAAGTGTAGGTGTATTAAAGCAATAATTCACTGCAGTATGATTTTACCTCACAAATAATCATCATCATGTCTTTGTAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21738
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 382 1104 11 26
ENSDART00000125665 Nonsense 373 1023 10 22
ENSDART00000140483 Nonsense 347 1056 10 20
Genomic Location (Zv9):
Chromosome 10 (position 26343721)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25747578
GRCz11 10 25709291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAATGGGGCAGCCGAACGCAGCTTTCCCTCCTCAAAATGAGGCCTTCAAT[C/T]AACTCATGTCTGGACATGCGGTAAAAGGATTGTGACTGATGTATAACAGG
Long Flanking Sequence:
CTTTGACTATGACGATGAGCCAGATGCAGGAGAGGATGCCAAGAAGGAGGAAGCGCAGTCTGTCCAACCTTCTATGTATACAGAATCTCCTTTTCTAAATGTTGAAGTGCACAACATGCTTACTTTTGAGCAAGTTTTATAATTTGGTTAATCTTTGTCTCCACAGGGGTTTTCCTGAGCAAACTGTCCCAGGATTTCCTCCAGCCAATCAGATGCAGCACTTTCAACAGCATATGATGGCTGTATCACAGCGCCAACAGGTAGATTATCACAGCCTCCTTTTTTGGAAGGCATTTTTTGCCTAATATTTAATCAGATGACATTTATCTGTGATTTATTATTCCCTAGTCATGTTTTGGTTTTGATGTGCTCAGGTTGTTCTACCTTCAAATGGACAGGTCCAAGGCTTTGGTCTCATGACCTCTCAGCCCTATCCAGGCATGATGCCTCCAATGGGGCAGCCGAACGCAGCTTTCCCTCCTCAAAATGAGGCCTTCAAT[C/T]AACTCATGTCTGGACATGCGGTAAAAGGATTGTGACTGATGTATAACAGGGAAAAACTGCCATTAAATCTTACACTAATCATTATTCGATTCTGTCACAGGAAAGTCTGATGAATTCAGATGCATCTGCGAGGTCTGCCCATGAAGACAAGAGGTCAAGGTCACGCTCGGGGTCGAGGTGTGTACACAAAAATCCTTATGAACAACAATAACCATTCATCTAAAGCTCACAGTTTTTATTTTGAGTCCTTGCGGCAAGGTTAGAGGGTCATGAACCAGTACAATAACATTTTAGACTTTTATTTCACTTCGCCTGCCTTAAAGAGATAATTCACCCCAAAAGATCAATTCTTTCATAATTTAATCACCTTTTACTTGTTCAAATATACAGAATTTTTTTCCTACTATGGAGATCGATGGGTCCCAGCAATACTTTCTTTTGTGTTCCAACAGTAGAAAGAAACTCATAAAGGTTTAAAACCACATGAGAGAGAGTAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34908
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 411 1104 13 26
ENSDART00000125665 None None 1023 None 22
ENSDART00000140483 None None 1056 None 20
Genomic Location (Zv9):
Chromosome 10 (position 26343174)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25747031
GRCz11 10 25708744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGATAACATAATTTTTCTTTTAGGTGAACTCTCTCTTTAAAAGCATGT[T/A]GGTTTCCTGCAAATATATGCTGCAATTGACCATTAAACACAACAAAACGT
Long Flanking Sequence:
CAGGGAAAAACTGCCATTAAATCTTACACTAATCATTATTCGATTCTGTCACAGGAAAGTCTGATGAATTCAGATGCATCTGCGAGGTCTGCCCATGAAGACAAGAGGTCAAGGTCACGCTCGGGGTCGAGGTGTGTACACAAAAATCCTTATGAACAACAATAACCATTCATCTAAAGCTCACAGTTTTTATTTTGAGTCCTTGCGGCAAGGTTAGAGGGTCATGAACCAGTACAATAACATTTTAGACTTTTATTTCACTTCGCCTGCCTTAAAGAGATAATTCACCCCAAAAGATCAATTCTTTCATAATTTAATCACCTTTTACTTGTTCAAATATACAGAATTTTTTTCCTACTATGGAGATCGATGGGTCCCAGCAATACTTTCTTTTGTGTTCCAACAGTAGAAAGAAACTCATAAAGGTTTAAAACCACATGAGAGAGAGTAAATGATAACATAATTTTTCTTTTAGGTGAACTCTCTCTTTAAAAGCATGT[T/A]GGTTTCCTGCAAATATATGCTGCAATTGACCATTAAACACAACAAAACGTACTTCTATTCCACACACCTTCGTAAGCTCCCTGTATTTTACACAACACACATGCCCCTTGTCTGCTATGTTTAATTAACAAATAAATGCACACTCGTGTGTATTTTAACTCTGCATGAAAAAAAAAATAGTCTTTTTTTGCAAGGATAAACCAGAAGAATGGCTCATCAAGATGATATGAAATATTTAAATTTCTTCTGCAATTGTAAATCATTGTAATTGTATATCATTGTATTCTGTGATTTGTTACAAAAACATGAAATCCTAGAAAAATATAGTAAATTGTAAATGGGGATGTTGTTTTTTCAGGTCTCCTAAAAGAAGAAGGTCTCGATCCAATTCCCGGTCCAGACGAATGAGGCATCGACGATCTCGGTCTCGAGAACGGCGGCGTCAGTCACCTCGCTCGCGCTCTCAGGAAAGGAGAGACAGAGAAAAGGAAAGAGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24872
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 483 1104 15 26
ENSDART00000125665 Nonsense 430 1023 12 22
ENSDART00000140483 Nonsense 404 1056 12 20
Genomic Location (Zv9):
Chromosome 10 (position 26342742)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25746599
GRCz11 10 25708312
KASP Assay ID:
554-7436.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCAATTCCCGGTCCAGACGAATGAGGCATCGACGATCTCGGTCTCGA[G/T]AACGGCGGCGTCAGTCACCTCGCTCGCGCTCTCAGGAAAGGAGAGACAGA
Long Flanking Sequence:
ACCACATGAGAGAGAGTAAATGATAACATAATTTTTCTTTTAGGTGAACTCTCTCTTTAAAAGCATGTTGGTTTCCTGCAAATATATGCTGCAATTGACCATTAAACACAACAAAACGTACTTCTATTCCACACACCTTCGTAAGCTCCCTGTATTTTACACAACACACATGCCCCTTGTCTGCTATGTTTAATTAACAAATAAATGCACACTCGTGTGTATTTTAACTCTGCATGAAAAAAAAAATAGTCTTTTTTTGCAAGGATAAACCAGAAGAATGGCTCATCAAGATGATATGAAATATTTAAATTTCTTCTGCAATTGTAAATCATTGTAATTGTATATCATTGTATTCTGTGATTTGTTACAAAAACATGAAATCCTAGAAAAATATAGTAAATTGTAAATGGGGATGTTGTTTTTTCAGGTCTCCTAAAAGAAGAAGGTCTCGATCCAATTCCCGGTCCAGACGAATGAGGCATCGACGATCTCGGTCTCGA[G/T]AACGGCGGCGTCAGTCACCTCGCTCGCGCTCTCAGGAAAGGAGAGACAGAGAAAAGGAAAGAGAACGAAGACAGAAAGGCCTCCCTCCTGTTAAAAATAACACACTCAGTGGTAAGAAGGCCACTTTCACTTCTAAGTATACATAACACACTACTGAACCTTAGGTGTGGGTGATTCATCAAAATAAAATTGCAAACACATTTATGCAAAGCTGCGATTGTCATGCACATCCGGGAAGCATGGTTCTGTGAAATCTCAGATGATGGATAGAGGGCGCTCTTGTGTGGAAACTCCAAAAAAACAGCAAAGAAGAGACTAGGGTTTGGATGATTGATGCTGCTCTTAATTCAGAATGGCTCATCCCTATGCTCTAATCACTTCAAAGTGTTAACCCTTTAAAGTGACTGCTTCAAAGGGATGAAGGGTGCAGTGGTCAAAAAATAATTTTTTGGAACGCATTTTTGCGTCGTCATAACGAGACAATCGAGGAGGTGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa736
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Essential Splice Site 688 1104 19 26
ENSDART00000125665 Missense 636 1023 16 22
ENSDART00000140483 None None 1056 None 20
Genomic Location (Zv9):
Chromosome 10 (position 26338692)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25742549
GRCz11 10 25704262
KASP Assay ID:
554-0643.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCATACCTATGCAGGTAAAGCAACATTGCCTGATTCATATGYATTCAA[G/A]TTTGGGTTTGTACTATTTATTTATTCTTTTTTTAATTATTCATCWTCAGG
Long Flanking Sequence:
CTAATACCATTGTTTACTGCAATTTGTGTAGGTTTGATTTGAAAAAAATGCTTTAAAGCAGGGGTGTCCAAACTCGGTCTTGGAGAACCAGTGTCCTGCTGAGTTTAGCTCCAACTTGCTTCAACAAACCAGCCAGGAAGTTTATAGTTTATCTAGTAAGAGCTTGATTAACTTGTTCATGTGTGTTTGATTAGGGTTGGAGTTAAACTGTTCAGGACACCGGCCCTCTAGGACTGAGTTTGAACACCCCTATTTTAAAGCATTGTTTTTTATTTGATACTCTTCTTCTGAAGACATAGAATATTAGTCAGCTTGATTTGTCAGCTTTGAGGACACACAGTTATACGTGATTTATCCTTATACAGAATGGCGAAACTCTCAGATTGAACAGAAGACTGATGAGTCTCAGAACGGCCGGCCAGAGGTGGGAAAAGTGGAAGAGACCCAAACTGTCATACCTATGCAGGTAAAGCAACATTGCCTGATTCATATGCATTCAA[G/A]TTTGGGTTTGTACTATTTATTTATTCTTTTTTTAATTATTCATCATCAGGTTCCTCCTGTCCAGCCAATAGGAGCAGTCGGTGTCCCACCTCCGGGATTCCCAGCACACATGAACATCCCACCACCCTCATTCCCACCTGGTGTTCCTCCACCTCCAGGTCCCTTCATGCGGCCAGCCTTTAACCCCATGCAGATGCCACCAGGTATAGAAATAATACTCACACAGCATTAATTATAGATGTTTGTGTCCATTTTCCAACACGTATAGTTTTTTTCTTTCAGGATTTCTCCCACCGGGTGCCATGCCCCATATGGGTGCTGCTGGCCCTCCTCCACCTACAGCAGGCATCGGGATGCCTCCAGGTGGGCAGTCTTCAATTTATACACTTTAGCTTTAATTTAATGGTATGGATTTCAGCAGTAATTCTTCCTGTGTAATATTGAGACAGTCATACTAATCTCATTTTGCCTTTTTAATCGCTGTAGTTGGCAGCTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41664
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Essential Splice Site 771 1104 21 26
ENSDART00000125665 Missense 721 1023 18 22
ENSDART00000140483 Essential Splice Site 676 1056 18 20
Genomic Location (Zv9):
Chromosome 10 (position 26338328)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25742185
GRCz11 10 25703898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGTGCTGCTGGCCCTCCTCCACCTACAGCAGGCATCGGGATGCCTCCAG[G/A]TGGGCAGTCTTCAATTTATACACTTTAGCTTTAATTTAATGGTATGGATT
Long Flanking Sequence:
GAATGGCGAAACTCTCAGATTGAACAGAAGACTGATGAGTCTCAGAACGGCCGGCCAGAGGTGGGAAAAGTGGAAGAGACCCAAACTGTCATACCTATGCAGGTAAAGCAACATTGCCTGATTCATATGCATTCAAGTTTGGGTTTGTACTATTTATTTATTCTTTTTTTAATTATTCATCATCAGGTTCCTCCTGTCCAGCCAATAGGAGCAGTCGGTGTCCCACCTCCGGGATTCCCAGCACACATGAACATCCCACCACCCTCATTCCCACCTGGTGTTCCTCCACCTCCAGGTCCCTTCATGCGGCCAGCCTTTAACCCCATGCAGATGCCACCAGGTATAGAAATAATACTCACACAGCATTAATTATAGATGTTTGTGTCCATTTTCCAACACGTATAGTTTTTTTCTTTCAGGATTTCTCCCACCGGGTGCCATGCCCCATATGGGTGCTGCTGGCCCTCCTCCACCTACAGCAGGCATCGGGATGCCTCCAG[G/A]TGGGCAGTCTTCAATTTATACACTTTAGCTTTAATTTAATGGTATGGATTTCAGCAGTAATTCTTCCTGTGTAATATTGAGACAGTCATACTAATCTCATTTTGCCTTTTTAATCGCTGTAGTTGGCAGCTCTGTTGAAAACCTGTCGAATGATTCAGCAGGTCTGGGCCCAAAAATCAGCACTGATGGAGCAGATGTGTTCAACTCAGGTGGGTCTATGTATAGATTTATTTAACACTAGATATTTCTTTAAACTGTACATAGTTTTTTTCCCCCAAAATATTTGTTTTTTTAATACAAAATTCTATAGAATTAGCTTTAAAGGTTCAAGAGACCCTGCAGTACTTGTTTTGCTATTTTAACAGATTTGTGTGTGTTGAACATCAGTTAAGAGAACTTTAGCACCTGTTAGTTTAATTGTGGGAAAAACTGGATACTTTTGAGTTTTTGTCAGCTAATTTCATCTTCGGGGTTTAAAATAATTTTTGGGGCAGGATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 1023 1104 26 26
ENSDART00000125665 Nonsense 965 1023 22 22
ENSDART00000140483 Nonsense 890 1056 20 20
Genomic Location (Zv9):
Chromosome 10 (position 26336291)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25740148
GRCz11 10 25701861
KASP Assay ID:
554-7593.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAAAGAGAACGCAGGGAGGAACGCTGGAGGAGAAGTCCAGATGGAGAA[C/T]GAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGG
Long Flanking Sequence:
CTGGTCTTCTTGGCACAAGGCCAGGTATGATGCCTCTTCAGCGGCCCCCGGGGATGCCACCTCCGCACATGCAGCGATTCCCCATTCCCCCACCTCGGGCAGGCATGCCACCCATGCCACCACAGATGATGCCACCCAGGGGTCCACCTCAGATGATGCACCGCGAACCTCCACCGGGTGGTTTCAGCATGCCTCCTCCACCTCATGGCATCCGGGGACCGTTCCCACCTCCCGGACCTCACTTTATGAGGCCGAGCTTACCAAGGCCTGAGGGGCCAAATGATCATGAGGCTCGACCTTTTAGAGGAGAACGTCCCGGATTAGGAAGAGGCCGAGAGCAGGACTGGTTTGGAGGACGACGGCCTTTTGGTGAGGGACGTGGTGGGGAAAGACCAGATGGACGTGAGCGGTTTGGAGGATGGCACGAGGAGCCAGAGAAACCAGGTGGGTGGGAAAGAGAACGCAGGGAGGAACGCTGGAGGAGAAGTCCAGATGGAGAA[C/T]GAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGGGAAAGAGGACGCGATGGTGGAGAGAGGGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAGAGGGAACGAGGACGCGATACTGGAGAGCGGGAACGAGGCCGCGATGGTGAAGAACGGACCAAGCGGCCCGCAGGGAGCAGAGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGATCGATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCTCAGCAAATACCAACGAGCCCAGTGCAAACCCTACTAAAGAACTTGCTGAAGCCAAGCCAGATGTTCCAGCACCTTCTGCTGCAGCTACAGCAGACTCGGAAGCTTCAGAACCCATAGCAGAGAACAAATCTGAAGAACAAACACAAAAAGAGGAGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13563
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 1042 1104 26 26
ENSDART00000125665 Nonsense 984 1023 22 22
ENSDART00000140483 Nonsense 909 1056 20 20
Genomic Location (Zv9):
Chromosome 10 (position 26336234)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25740091
GRCz11 10 25701804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGGGAAAGA[G/T]GACGCGATGGTGGAGAGAGGGARCGAGGACGTGATGGTGGAGAGAGGGAA
Long Flanking Sequence:
CACCTCCGCACATGCAGCGATTCCCCATTCCCCCACCTCGGGCAGGCATGCCACCCATGCCACCACAGATGATGCCACCCAGGGGTCCACCTCAGATGATGCACCGCGAACCTCCACCGGGTGGTTTCAGCATGCCTCCTCCACCTCATGGCATCCGGGGACCGTTCCCACCTCCCGGACCTCACTTTATGAGGCCGAGCTTACCAAGGCCTGAGGGGCCAAATGATCATGAGGCTCGACCTTTTAGAGGAGAACGTCCCGGATTAGGAAGAGGCCGAGAGCAGGACTGGTTTGGAGGACGACGGCCTTTTGGTGAGGGACGTGGTGGGGAAAGACCAGATGGACGTGAGCGGTTTGGAGGATGGCACGAGGAGCCAGAGAAACCAGGTGGGTGGGAAAGAGAACGCAGGGAGGAACGCTGGAGGAGAAGTCCAGATGGAGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGGGAAAGA[G/T]GACGCGATGGTGGAGAGAGGGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAGAGGGAACGAGGACGCGATACTGGAGAGCGGGAACGAGGCCGCGATGGTGAAGAACGGACCAAGCGGCCCGCAGGGAGCAGAGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGATCGATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCTCAGCAAATACCAACGAGCCCAGTGCAAACCCTACTAAAGAACTTGCTGAAGCCAAGCCAGATGTTCCAGCACCTTCTGCTGCAGCTACAGCAGACTCGGAAGCTTCAGAACCCATAGCAGAGAACAAATCTGAAGAACAAACACAAAAAGAGGAGTCGTAGAGGCTTCTTTACTCATTAAGACCACATGAGCTTCTTCTGTGTCAGTGCTAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38801
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 Nonsense 1086 1104 26 26
ENSDART00000125665 None None 1023 None 22
ENSDART00000140483 Nonsense 953 1056 20 20
Genomic Location (Zv9):
Chromosome 10 (position 26336102)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25739959
GRCz11 10 25701672
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGCGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAGAGGGAA[C/T]GAGGACGCGATACTGGAGAGCGGGAACGAGGCCGCGATGGTGAAGAACGG
Long Flanking Sequence:
TGCCTCCTCCACCTCATGGCATCCGGGGACCGTTCCCACCTCCCGGACCTCACTTTATGAGGCCGAGCTTACCAAGGCCTGAGGGGCCAAATGATCATGAGGCTCGACCTTTTAGAGGAGAACGTCCCGGATTAGGAAGAGGCCGAGAGCAGGACTGGTTTGGAGGACGACGGCCTTTTGGTGAGGGACGTGGTGGGGAAAGACCAGATGGACGTGAGCGGTTTGGAGGATGGCACGAGGAGCCAGAGAAACCAGGTGGGTGGGAAAGAGAACGCAGGGAGGAACGCTGGAGGAGAAGTCCAGATGGAGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGGGAAAGAGGACGCGATGGTGGAGAGAGGGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAGAGGGAA[C/T]GAGGACGCGATACTGGAGAGCGGGAACGAGGCCGCGATGGTGAAGAACGGACCAAGCGGCCCGCAGGGAGCAGAGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGATCGATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCTCAGCAAATACCAACGAGCCCAGTGCAAACCCTACTAAAGAACTTGCTGAAGCCAAGCCAGATGTTCCAGCACCTTCTGCTGCAGCTACAGCAGACTCGGAAGCTTCAGAACCCATAGCAGAGAACAAATCTGAAGAACAAACACAAAAAGAGGAGTCGTAGAGGCTTCTTTACTCATTAAGACCACATGAGCTTCTTCTGTGTCAGTGCTAATCTTGAATACTGCTGGCTAAAAAGCAAAGTCCAACTGTTGTGGGACGCTTTATGCATATGAGGATTGCTTCGTCATCACAAACCAAGTTTTTCAAATTTGTGTTTTGGCAAACGTGGAGCGTTGCCTTGTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5829
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108981 None None 1104 None 26
ENSDART00000125665 None None 1023 None 22
ENSDART00000140483 Nonsense 991 1056 20 20
Genomic Location (Zv9):
Chromosome 10 (position 26335988)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25739845
GRCz11 10 25701558
KASP Assay ID:
554-3906.1 (used for ordering genotyping assays)
KASP Sequence:
CAGGGAGCAGAGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGAT[C/T]GATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCTCAGCAAATACC
Long Flanking Sequence:
GAGGAGAACGTCCCGGATTAGGAAGAGGCCGAGAGCAGGACTGGTTTGGAGGACGACGGCCTTTTGGTGAGGGACGTGGTGGGGAAAGACCAGATGGACGTGAGCGGTTTGGAGGATGGCACGAGGAGCCAGAGAAACCAGGTGGGTGGGAAAGAGAACGCAGGGAGGAACGCTGGAGGAGAAGTCCAGATGGAGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGAGGGAAAGAGGACGCGATGGTGGAGAGAGGGAACGAGGACGTGATGGTGGAGAGAGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGATGGTGGAGAGCGGGAACGAGGACGCGAAGGTGGAGAGAGGGAACGAGGACGCGATACTGGAGAGCGGGAACGAGGCCGCGATGGTGAAGAACGGACCAAGCGGCCCGCAGGGAGCAGAGAGAGGAGCACACGCTGGGACCGCGACGATAGACTCGAT[C/T]GATTGGGTCTGGCCGGCGAGGAACCCAATGAGAGACTCTCAGCAAATACCAACGAGCCCAGTGCAAACCCTACTAAAGAACTTGCTGAAGCCAAGCCAGATGTTCCAGCACCTTCTGCTGCAGCTACAGCAGACTCGGAAGCTTCAGAACCCATAGCAGAGAACAAATCTGAAGAACAAACACAAAAAGAGGAGTCGTAGAGGCTTCTTTACTCATTAAGACCACATGAGCTTCTTCTGTGTCAGTGCTAATCTTGAATACTGCTGGCTAAAAAGCAAAGTCCAACTGTTGTGGGACGCTTTATGCATATGAGGATTGCTTCGTCATCACAAACCAAGTTTTTCAAATTTGTGTTTTGGCAAACGTGGAGCGTTGCCTTGTGAATTTATTGTCCCACCTCAATGAAGCTTGAATGTTGTATTAAAACTGAAGATAAGGAAAAGAAACGATTAATTGTTTGCTGTACATATGCTAACATTACTCCAATAATGTTTGTAGAT
Associated Phenotype:
Not determined