Busch Lab

ZMP

si:ch73-92e7.2

Ensembl ID:
ENSDARG00000077078
ZFIN IDs:
ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-071004-108, ZDB-GENE-081030-2
Description:
hypothetical protein LOC100126120 [Source:RefSeq peptide;Acc:NP_001103318]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa29690 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43746 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106329 Essential Splice Site None 452 None 5
ENSDART00000106406 None None 452 None 5
ENSDART00000106425 None None 452 None 5
ENSDART00000115348 None None 452 None 5
ENSDART00000145611 None None 16 None 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 1611575)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2352665
GRCz11 22 2368931
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGTCAGCGCTGACGCGTTCATTCAGCGTCGAGTCTTCAGAGCTGAGG[T/G]GAGTCGTTGACGCTTTTTCTCGTGTTTACACGACAATAAAACACACTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43746
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106329 Nonsense 232 452 5 5
ENSDART00000106406 Nonsense 232 452 5 5
ENSDART00000106425 Nonsense 232 452 5 5
ENSDART00000115348 Nonsense 232 452 5 5
ENSDART00000145611 None None 16 None 2
Genomic Location (Zv9):
Chromosome 22 (position 1763452)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2504542
GRCz11 22 2520808
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCTTATTCATGTTCTGAGTGTGGAAAGAGGTTTACACTGCTGCCATATT[T/A]AAAAAAACACGTTAAGATCCACACTGGTGTGAAAGAGTTCGTCTGCTCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4190
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106329 Nonsense 403 452 5 5
ENSDART00000106406 Nonsense 403 452 5 5
ENSDART00000106425 Nonsense 403 452 5 5
ENSDART00000115348 Nonsense 403 452 5 5
ENSDART00000145611 None None 16 None 2
Genomic Location (Zv9):
Chromosome 22 (position 1763964)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2505054
GRCz11 22 2521320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAGAGGCTGTACAAGTGTTCACACTGCGATAAGAGATTTAGGCAGTTA[C/T]AGATTCTGAAAAACCATGAAAGGACTCACACTAAAGAGAAGCCGAACACA
Associated Phenotype:
Not determined